We narrowed to 682 results for: RON
-
TypeCollection...protein) in striatal Pvalb+ neurons. Note strong cortical Pvalb and L5 ET neuron expression. Jonathan Ting.... AAV vector for strong & rapid SYFP2 expression in forebrain GABAergic interneurons. The enhancer core...dTomato_nlsdTomato AAV construct with dTomato driven by Lamp5 interneuron-targeting enhancer. Alias: pAAV_WDL0003_dTomato_nlsdTomato...Expression of CoChR-EGFP in striatal cholinergic neurons Jonathan Ting Viviana Gradinaru 214862-PHPeB AiP14825...Expression of iCre(R297T) in striatal medium spiny neurons Jonathan Ting Viviana Gradinaru 214858-PHPeB AiP14496...separate nuclear FLAG epitope in striatal cholinergic neurons Jonathan Ting Viviana Gradinaru 214857-PHPeB AiP14361...
-
Plasmids for Stem Cell Research
TypeCollection...Single polycistronic lentiviral vector for the expression of human Oct4, Sox2, and Klf4 Polycistronic lentiviral...Minicircle Human Non-integrating mini-intronic plasmid (MIP) polycistronic expression of human Oct4, Klf4, ...functional midbrain dopaminergic neurons using a single polycistronic vector. PLoS One. 2011;6(12):e28719...Fibroblasts Neurons Lentiviral Mouse Direct conversion of fibroblasts to functional neurons by defined ...Dopaminergic Neurons Lentiviral Human Direct conversion of human fibroblasts to dopaminergic neurons. Proc Natl...Fibroblasts Neurons Lentiviral Human MicroRNA-mediated conversion of human fibroblasts to neurons. Nature....cholinergic neurons. Nat Commun. 2013;4:2183. Zhang Fetal Lung Fibroblasts Cholinergic Neurons Lentiviral... -
Immunology Research Plasmids and Resources
TypeCollection...IFNA10 interferon, alpha 10 MGC119878, MGC119879 IFNA13 interferon, alpha 13 - IFNA14 interferon, alpha...IFNA16 interferon, alpha 16 - IFNA17 interferon, alpha 17 IFNA, INFA, LEIF2C1 IFNA2 interferon, alpha ...MGC142200 IFNA5 interferon, alpha 5 INFA5 IFNA6 interferon, alpha 6 - IFNA7 interferon, alpha 7 IFNA-J IFNA8... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection... 527 51 6.9 Prone to dimerization pcDNA3-YFP - Mammalian Expression Topaz 514 527 57 Prone to dimerization...35 min Prone to dimerization pcDNA3-mNeptune2-N - Mammalian Expression mNeptune2 600 650 21 Prone to dimerization...Bacterial Expression Dronpa3 490 515 405 (Off to On) 490 (On to Off) 19 Monomer Dronpa3-N1 - Mammalian Expression...Expression Dronpa3-C1 - Mammalian Expression Dronpa 503 518 400 (Off to On) 503 (On to Off) 81 40 min ...Many FPs are monomers at low concentration but are prone to dimerization at high concentration. Proteins ...Maturation Structure Plasmids Sirius 355 424 4 3.0 Prone to dimerization Sirius-N1 - Mammalian Expression...-C1 - Mammalian Expression Azurite 383 450 14 5 Prone to dimerization pLV-Azurite - Mammalian Lentiviral... -
Deisseroth INTRSECT Collection
TypeCollection...window) Cummings KA, Clem RL. 2020. Prefrontal somatostatin interneurons encode fear memory. Nat Neurosci...to single-component cellular definitions (e.g. neurons defined by a single gene or projection). Intersectional...Image from Fenno et al., 2014. INTRSECT INTRSECT (intronic recombinase sites enabling combinatorial targeting...and Flp) recognition sequences within synthetic introns. INTRSECT was first shown as a proof-of-concept.... Figure 2: INTRSECT works by inserting short, intronic sequences into the open reading frame (ORF) of...sequences (e.g. Lox sites, FRT sites) inside of the introns (A,D). The addition of these recombinase recognition... combinations of recombinases are present, the introns are excised during mRNA processing, producing a... -
COVID-19 Resources
TypeCollection...COVID-19 and Coronavirus Plasmids & Resources Antibodies SARS-CoV-2 Plasmids Other Coronavirus Plasmids Mammalian... molecular tools and resources available for Coronavirus research. Plasmid...Kostman for the Innovative Genomics Institute The Coronavirus Disease-2019 (COVID-19) pandemic was caused by... by a novel virus strain from the Coronaviridae family called SARS-CoV-2. In 2020, scientists worked at...knowledge and understanding of COVID-19 and related coronaviruses. Addgene assisted this effort by providing a...2 Spike Protein Variants Return to top Other Coronavirus Plasmids: SARS-CoV, MERS, BAT-CoV Plasmids ID...have been identified as having a key role in coronavirus infection, such as ACE2 and TMPRSS2, which are... -
Neurodegeneration Research Collection
TypeCollection...and lower motor neurons in the brain and spinal cord. Over time, a loss of motor neurons leads to limb ...progressive degeneration and ultimate death of neurons. Common neurodegenerative diseases include Alzheimer...CRISPR screens to understand more globally how neurons function. They are also delving into new technologies...polyglutamine sequences. These glutamine-rich sequences are prone to misfolding and aggregation and can interfere ...Parkinson's Disease Parkinson’s disease (PD) is a chronic and progressive neurological disorder that primarily...the malfunction and death of dopamine-producing neurons in the substantia nigra, one of the movement control...control centers in the brain. The cause of this neuron death is unknown. Despite the idiopathic (having... -
Lentivirus Plasmids
TypeCollection...transfer plasmids Trono 12259 pMD2.G N/A Envelope VSV-G-expressing envelope plasmid Trono 8454 pCMV-VSV-G...transgene expression, contains intron that gives you high expression. Trono 12254 pWPI 2nd EF-1alpha driven...plasmids along with additional packaging components Trono 63586 psPAX2-D64V 2nd Packaging For making Integrase...transfer plasmids along with a plasmid encoding Rev Trono 12260 psPAX2 2nd Packaging Contains Gag, Pol, Rev...used with 2nd and 3rd generation transfer plasmids Trono 12263 pCMV delta R8.2 2nd Packaging Contains Gag...under the control of a tet-responsive H1 promoter Trono 11651 pLVUT-tTR-KRAB 3rd Inducible expression of...about cloning & additional plasmids. Aebischer and Trono 11795 pLL3.7 3rd Expresses shRNA under mouse U6 ... -
E11 Bio PRISM Collection
TypeCollection... machine-learning segmentation of neurons and proofreading of neuron reconstructions. This minimizes the...Reconstruction of a sparse set of neurons across 10 million cubic microns of mouse hippocampus using PRISM...for high-throughput reconstruction of individual neurons in brain tissue developed by scientists at E11 ...enabling high-throughput reconstruction of individual neurons in brain tissue. PRISM begins with the delivery...#242782–242799) suitable for targeting specific neuron subtypes in Cre-driver lines. These could also ...with expansion microscopy and reconstruction of neurons with machine learning. Adapted from Park & Sheridan...Combinatorial protein barcodes enable self-correcting neuron tracing with nanoscale molecular context . bioRxiv... -
Tetracycline Inducible Expression
TypeCollection...scientists have adapted an antibiotic resistance operon from E. coli : the tetracycline repressor protein... reversed (Figure 1). However, rtTA can induce stronger expression of the downstream gene via its activation...plasmids. tetR-KRAB TRE Patrick Aebischer , Didier Trono 41393 pCW57.1 Lentiviral Tet-On vector for inducible...Kaufman 175274 pAAV-rtTA AAV Tet-On vector with neuron-specific expression of rtTA3 from hSyn promoter...TRE3GS promoter for conditional auxin-inducible degron system Masato Kanemaki 92099 AAVS1_Puro_Tet3G_3xFLAG_Twin_Strep...plasmid for differentiating iPSCs into glutamatergic neurons via human NGN2 expression. See more from the iPSC...harbor site, for iPSC differentiation into cortical neurons Michael Ward 100798 pAAV-syn-FLEX-splitTVA-EGFP-tTA... -
Optogenetics AAV Preps
TypeCollection...Constitutive 9 Christopher Harvey 59170 pAAV-Syn-Chronos-GFP Syn Chronos GFP Constitutive 1, 5, rg* Edward Boyden...dependent 1, 5 Edward Boyden 62726 pAAV-Syn-Chronos-tdTomato Syn Chronos tdTomato Constitutive 8 Edward Boyden...neuroscience to control electrical potentials in neurons. See our Optogenetics Plasmids and Optogenetics...Wild-type ChR2 ChR2/H134R soCoChR ChR2/other mutants Chronos, Chrimson, ChRmine, ChroME, ChETA, C1V1 (t/t) Inhibitory... -
AAV Molecular Tools
TypeCollection...used for neurophysiology experiments, including neuronal connectivity labeling. ID Name Expression System...TEVp EF1a-driven, Cre-dependent Cre-dependent, bicistronic expression of designer pro-taCasp3 and TEVp for...expression of Kir2.1 and mScarlet-KASH for silencing neurons 8 Ivo Spiegel Anterograde Transsynaptic Tracers...direction across synapses. Also see Monosynaptic Neuronal Tracers available at Addgene. ID Name Expression...protein to express in presynaptic glutamatergic neurons, Cre payload. Must use with AAV8-DIO-Reporter viruses... -
Bacterial Expression Systems
TypeCollection...activity Fluorescence (GFPmut3a) and luminescence (lux operon) Gram-negative bacteria Attila Karsi 14080 pAKlux2...pAKlux2 Promoter activity Luminescence (lux operon) Gram-negative bacteria Attila Karsi 14076 pAKgfp1 Promoter...pMV306hsp+LuxG13 Promoter activity Luminescence (lux operon) Mycobacterium sp. Brian Robertson , Siouxsie Wiles...pMV306hsp+Lux Promoter activity Luminescence (lux operon) Mycobacterium sp. Brian Robertson , Siouxsie Wiles...pMV306G13+Lux Promoter activity Luminescence (lux operon) Mycobacterium sp. Brian Robertson , Siouxsie Wiles...78565 pCM18 Promoter activity Luminescence (lux operon) Vibrio cholerae James Kaper Additional Addgene... -
Biosensor AAV Preps
TypeCollection...Boyden Voltage Reporter: Voltron 119036 pAAV-hsyn-flex-Voltron-ST Syn Voltron-ST none Cre dependent 1 ...Oxytocin (OT) Sensors GRAB_OT Voltage Sensors Archon Voltron JEDI-2P ASAP ATP Sensors iATPSnFR2 5-HT Sensors...pAAV-hSynapsin1-axon-GCaMP6s-P2A-mRuby3 Syn axon-GCaMP6s bicistronic mRuby3 Constitutive 5, 9 Tian 112010 pAAV-hSynapsin1...Schreiter 172907 pGP-AAV-syn-FLEX-Volton2-ST-WPRE Syn Voltron2-ST none Cre dependent 1 GENIE Voltage Reporter... -
Validated gRNA Sequences
TypeCollection...26616834 Patron lC.GA4a B. oleracea GTTTTCACTTGCGGCCGGAG 68255 cut S. pyogenes 26616834 Patron leu2 S. ... 26616834 Patron PM19 H. vulgare GGCTGGCGTTGGTCGTAACA 68254 cut S. pyogenes 26616834 Patron Prnp M. musculus...59724 cut S. pyogenes 25543152 Hanna BT1754 B. thetaiotaomicron GAAAATGGGGTGTATCCTGC 68892 interfere S. pyogenes...pyogenes 26918244 Lu BT1854 B. thetaiotaomicron ATTGAAGAACAAAAGCAGTT 68891 interfere S. pyogenes 26918244... -
Luciferase Plasmid Collection
TypeCollection...contain introns Anthony Leung Return to Top Expression Constructs Luciferase driven by a strong constitutive...reporter reporter vector allowing the study of biscistronic promoters. Daniel Christophe 119760 pSGDlucV3.0...expression of firefly luciferase and iRFP720 from a bicistronic promoter Antonius Plagge 118017 pLX313-Firefly...for bioluminescent chemo-optogenetic control of neuronal signaling. TRUPATH Kit , ONE-GO Biosensors Kit... -
Structural Genomics Consortium Plasmids
TypeCollection...Resources SGC: www.thesgc.org SGC Toronto: www.thesgc.org/scientists/groups/toronto Protein Database (PDB): www.pdb.org...without restriction. Many SGC plasmids from the Toronto, Oxford and Stockholm sites have been deposited...the SGC Plasmid Collection By All Plasmids SGC Toronto SGC Oxford SGC Stockholm Bacterial Expression Plasmids... -
Optogenetics Plasmid Collection
TypeCollection...specific neurons, often utilizing viral expression systems, to activate or deactivate these neurons in a .... When using these opsins as a tool to control neuronal activity, scientists generally attach a fluorescent... table below for the optogenetics plasmids for neuronal excitation and inhibition. For example, search... -
Antibody Guide
TypeCollection... more expensive than polyclonal antibodies. Environmental factors, binding partners, location in the cell...antigen. Polyclonal antibodies are often more environmentally stable and more cost-effective. They are useful...are synthetic binding proteins which use the Fibronectin type III domain as their scaffolding instead ...does not use cross-linking and instead relies on strong interactions between DNA and protein. Micrococcal...for DNA:histone modifier interactions, which have strong binding between the protein and DNA. Some ChIP ...different antibodies and do batch validation up front rather than risk delaying a process through sequential... -
Viral Production
TypeCollection...Edward Boyden (Addgene viral prep # 84445-AAVrg). Electron Microscopy The ratio of empty to full (i.e., genome...representative vector preparations was quantified with electron microscopy after negative staining. Empty vector...appear darker than full vector particles. Figure 3: Electron micrograph of AAV vector preparation shows that...psPAX2 and pMD2.G packaging system developed by the Trono lab . Cell culture medium (OptiPro SFM) containing...