...protein) in striatal Pvalb+ neurons. Note strong cortical Pvalb and L5 ET neuron expression. Jonathan Ting.... AAV vector for strong & rapid SYFP2 expression in forebrain GABAergic interneurons. The enhancer core...Expression of CoChR-EGFP in striatal cholinergic neurons Jonathan Ting Viviana Gradinaru 214862-PHPeB AiP14825...Expression of iCre(R297T) in striatal medium spiny neurons Jonathan Ting Viviana Gradinaru 214858-PHPeB AiP14496...separate nuclear FLAG epitope in striatal cholinergic neurons Jonathan Ting Viviana Gradinaru 214857-PHPeB AiP14361...jGCaMP8s in striatal indirect pathway medium spiny neurons (D2 MSNs) Jonathan Ting Viviana Gradinaru 214856...jGCaMP8s in striatal direct pathway medium spiny neurons (D1 MSNs) Jonathan Ting Viviana Gradinaru 214853...

... cheap and accessible) to massive transmission electron microscopes that allow us to see cellular components...

...IFNA10 interferon, alpha 10 MGC119878, MGC119879 IFNA13 interferon, alpha 13 - IFNA14 interferon, alpha...IFNA16 interferon, alpha 16 - IFNA17 interferon, alpha 17 IFNA, INFA, LEIF2C1 IFNA2 interferon, alpha ...MGC142200 IFNA5 interferon, alpha 5 INFA5 IFNA6 interferon, alpha 6 - IFNA7 interferon, alpha 7 IFNA-J IFNA8...

...Bacterial Expression Dronpa3 503 518 19 Monomer Dronpa3-N1 - Mammalian Expression Dronpa3-C1 - Mammalian Expression... 527 51 6.9 Prone to dimerization pcDNA3-YFP - Mammalian Expression Topaz 514 527 57 Prone to dimerization...35 min Prone to dimerization pcDNA3-mNeptune2-N - Mammalian Expression mNeptune2 600 650 21 Prone to dimerization...Many FPs are monomers at low concentration but are prone to dimerization at high concentration, so this is...Maturation Structure Plasmids Sirius 355 424 4 3.0 Prone to dimerization Sirius-N1 - Mammalian Expression...-C1 - Mammalian Expression Azurite 383 450 14 5 Prone to dimerization pLV-Azurite - Mammalian Lentiviral...-C1 - Mammalian Expression EBFP2 383 448 17 4.5 Prone to dimerization pBad-EBFP2 - Bacterial Expression...

...Background Information Anatomy of a Pipette This front view photo of a P1000 pipette shows the plunger ...

...window) Cummings KA, Clem RL. 2020. Prefrontal somatostatin interneurons encode fear memory. Nat Neurosci...to single-component cellular definitions (e.g. neurons defined by a single gene or projection). Intersectional...Image from Fenno et al., 2014. INTRSECT INTRSECT (intronic recombinase sites enabling combinatorial targeting...and Flp) recognition sequences within synthetic introns. INTRSECT was first shown as a proof-of-concept.... Figure 2: INTRSECT works by inserting short, intronic sequences into the open reading frame (ORF) of...sequences (e.g. Lox sites, FRT sites) inside of the introns (A,D). The addition of these recombinase recognition... combinations of recombinases are present, the introns are excised during mRNA processing, producing a...

... for utilizing SHERLOCK to detect coronavirus - Enabling coronavirus detection using CRISPR-Cas13: Open-access...DETECTR to detect coronavirus - A protocol for rapid detection of the 2019 novel coronavirus SARS-CoV-2 using... Medicine Coronavirus webpage PLOS Journals COVID-19 Collection Science Journals Coronavirus Collection... for Coronavirus research. Collections... Collections COVID-19 - Plasmids and Resources COVID-19 and Coronavirus Plasmids...knowledge and understanding of COVID-19 and related coronaviruses. To assist with this effort Addgene will maintain... may be of use to scientists. Background The Coronavirus Disease-2019 (COVID-19) pandemic is caused by...

...and lower motor neurons in the brain and spinal cord. Over time, a loss of motor neurons leads to limb ...progressive degeneration and ultimate death of neurons. Common neurodegenerative diseases include Alzheimer...CRISPR screens to understand more globally how neurons function. They are also delving into new technologies...polyglutamine sequences. These glutamine-rich sequences are prone to misfolding and aggregation and can interfere ...Parkinson's Disease Parkinson’s disease (PD) is a chronic and progressive neurological disorder that primarily...the malfunction and death of dopamine-producing neurons in the substantia nigra, one of the movement control...control centers in the brain. The cause of this neuron death is unknown. Despite the idiopathic (having...

...product is the anticipated size and that your band is strong (indicating that the PCR reaction worked and that...

...If the samples are running unevenly and the dye front looks like a “smile”, reduce the voltage. Turn off...

...transfer plasmids Trono 12259 pMD2.G N/A Envelope VSV-G-expressing envelope plasmid Trono 8454 pCMV-VSV-G...transgene expression, contains intron that gives you high expression. Trono 12254 pWPI 2nd EF-1alpha driven...plasmids along with additional packaging components Trono 63586 psPAX2-D64V 2nd Packaging For making Integrase...transfer plasmids along with a plasmid encoding Rev Trono 12260 psPAX2 2nd Packaging Contains Gag, Pol, Rev...used with 2nd and 3rd generation transfer plasmids Trono 12263 pCMV delta R8.2 2nd Packaging Contains Gag...under the control of a tet-responsive H1 promoter Trono 11651 pLVUT-tTR-KRAB 3rd Inducible expression of...about cloning & additional plasmids. Aebischer and Trono 11795 pLL3.7 3rd Expresses shRNA under mouse U6 ...

...targeted neuronal manipulation. Topics may include: How this technology is used for targeted neuronal manipulation...Series AAV Technologies and Methods for Targeted Neuronal Manipulation Meeting Date September 21, 2018 Contact... AAV-based molecular tools to achieve targeted neuronal manipulation (aka intersectional control). The...fit in the big picture of methods for targeted neuronal manipulation? Best practices for using this techonology... is presenting on) is used to achieve targeted neuronal manipulation. Figures, tables, data, or images...communication representing a reference for AAV use in neuronal intersectional control. Through your participation...Adeno-Associated Virus Technologies and Methods for Targeted Neuronal Manipulation. Haery L, Deverman BE, Matho KS, ...

...pLOX-CW-CRE Cre CMV Lentiviral Trono 12265 pHR-CMV-nlsCRE Cre CMV Lentiviral Trono 12493 p259 pCMV-CRE-M (BglII...newborn neurons Retroviral Luikart 66693 pRubiG-T2A-cre GFP and Cre expression in newborn neurons Retroviral...CREM (or Cre-M) has been engineered to contain an intron, preventing Cre expression when cloning in E. coli...including the polyadenylation site and several introns tet-hCMV Mammalian Sauer 12168 pMB80 (R26-CreER...AAV Aebischer 24704 GFAP-Cre Cre GFAP Mammalian Sofroniew 25997 LV-Cre pLKO.1 Cre and shRNA coexpression...pmSyn1-EBFP-Cre Cre-EBFP fusion; Expression in neurons. synapsin AAV Zeng 51904 paavCAG-iCre iCre CAG ...AAV-hSyn-mCherry-P2A-Cre-WPRE mCherry and Cre; expressed in neurons hSyn AAV Yang 107313 AAV-aCamkII-mCherry-P2A-Cre-WPRE-BGH-polyA...

...Biology CMV-LUC2CP/intron/ARE, CMV-LUC2CP/ARE : A splicing reporter that contains an intron in the middle ...expression constructs available that are driven by a strong constitutive promoter and can be used to monitor...so both Renilla and Firefly luciferase contain introns Anthony Leung 141285 pGWB401NL3F10H NanoLuc® Creation...Top Expression Constructs Luciferase driven by a strong constitutive promoter and can be used to monitor...firefly luciferase Scott Lowe 14080 pAKlux2 Lux Operon Bacterial expression of luciferase from broad host...expression of firefly luciferase and iRFP720 from a bicistronic promoter Antonius Plagge 118017 pLX313-Firefly...

...Boyden Voltage Reporter: Voltron 119036 pAAV-hsyn-flex-Voltron-ST Syn Voltron-ST none Cre dependent 1 ...Oxytocin (OT) Sensors GRAB_OT Voltage Sensors Archon Voltron JEDI-2P ATP Sensors iATPSnFR2 5-HT Sensors GRAB...pAAV-hSynapsin1-axon-GCaMP6s-P2A-mRuby3 Syn axon-GCaMP6s bicistronic mRuby3 Constitutive 5, 9 Tian 112010 pAAV-hSynapsin1...Schreiter 172907 pGP-AAV-syn-FLEX-Volton2-ST-WPRE Syn Voltron2-ST none Cre dependent 1 GENIE Voltage Reporter...

...26616834 Patron lC.GA4a B. oleracea GTTTTCACTTGCGGCCGGAG 68255 cut S. pyogenes 26616834 Patron leu2 S. ... 26616834 Patron PM19 H. vulgare GGCTGGCGTTGGTCGTAACA 68254 cut S. pyogenes 26616834 Patron Prnp M. musculus...59724 cut S. pyogenes 25543152 Hanna BT1754 B. thetaiotaomicron GAAAATGGGGTGTATCCTGC 68892 interfere S. pyogenes...pyogenes 26918244 Lu BT1854 B. thetaiotaomicron ATTGAAGAACAAAAGCAGTT 68891 interfere S. pyogenes 26918244...

...//www.thesgc.org/ SGC Toronto: https://www.thesgc.org/scientists/groups/toronto SGC Oxford: http://www.sgc.ox.ac.uk...without restriction. Many SGC plasmids from the Toronto, Oxford and Stockholm sites have been deposited...the SGC plasmid collection by All Plasmids SGC Toronto SGC Oxford SGC Stockholm Bacterial Expression Plasmids...

...specific neurons, often utilizing viral expression systems, to activate or deactivate these neurons in a .... When using these opsins as a tool to control neuronal activity, scientists generally attach a fluorescent... table below for the optogenetics plasmids for neuronal excitation and inhibition. For example, search...

... more expensive than polyclonal antibodies. Environmental factors, binding partners, location in the cell...antigen. Polyclonal antibodies are often more environmentally stable and more cost-effective. They are useful...are synthetic binding proteins which use the Fibronectin type III domain as their scaffolding instead ...does not use cross-linking and instead relies on strong interactions between DNA and protein. Micrococcal...for DNA:histone modifier interactions, which have strong binding between the protein and DNA. Some ChIP ...different antibodies and do batch validation up front rather than risk delaying a process through sequential...

...Edward Boyden (Addgene viral prep # 84445-AAVrg). Electron Microscopy The ratio of empty to full (i.e., genome...representative vector preparations was quantified with electron microscopy after negative staining. Empty vector...appear darker than full vector particles. Figure 3: Electron micrograph of AAV vector preparation shows that...psPAX2 and pMD2.G packaging system developed by the Trono lab . Cell culture medium (OptiPro SFM) containing...