Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 648 results for: ato

Showing: 621 - 640 of 648 results

  1. Using a Light Microscope Protocol

    Type
    Protocol
    ...research and are found in many different types of laboratories. These tools allow you to observe specimens ... in the future. Conclusion Like any important laboratory instrument, you should be sure to take care of...

  2. Pipetting Protocol

    Type
    Protocol
    ...liquid (think: 0.1 µL to 1 mL). When working in a laboratory, properly dispensing liquid ensures the accuracy...Reagents Liquid for pipetting Background Information Anatomy of a Pipette This front view photo of a P1000 pipette...

  3. DNA Quantification

    Type
    Protocol
    ... to protein (260/280) is generally used as an indicator of the purity of DNA samples. These days, many...

  4. Weighing Reagents Protocol

    Type
    Protocol
    ... reagents for a stock mixture is an essential laboratory technique, as imprecise measurements can affect...

  6. Fluorescence Titering Assay

    Type
    Protocol
    ...1000 µL single channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container Inverted...

  7. Gibson Assembly Protocol

    Type
    Protocol
    ...especially useful for introducing promoters, terminators, and other short sequences into the assembly ...

  8. General Transfection

    Type
    Protocol
    ...1000 µL single channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container Reagents...

  9. Promoters

    Type
    Guide
    ...by various DNA regulatory sequences including enhancers, boundary elements, insulators, and silencers....the RNA polymerase, an operator, a segment of DNA in which a repressor or activator can bind, and the structural...proximal promoter which contains many primary regulatory elements. The proximal promoter is found approximately...transcription factor binding sites, but mostly contains regulatory elements. Eukaryotic Promoters Eukaryotic Transcription... sequences. It is not unusual to have several regulatory elements such as enhancers several kilobases ...genes that are controlled by a single promoter and operator. Operons are common in prokayotes, specifically...its conformation, preventing its binding to the operator and thus allowing for transcription. The Lac operon...

  10. CRISPR Guide

    Type
    Guide
    ...effective gene activators when fused with dCas9. Recently, synthetic CRISPR-Cas gene activators have been ...zinc finger nucleases (ZFNs) or transcription-activator-like effector nucleases (TALENs) required scientists...fusing dCas9 to transcriptional repressors or activators and targeting promoter regions. You might sometimes...mice and human cells. The simplest dCas9-based activators and repressors consist of dCas9 fused directly...directly to a single transcriptional activator (e.g. VP64) or repressor (e.g. KRAB; Figure 9A). Other examples...co-expression of epitope-tagged dCas9 and antibody-activator effector proteins; long-term imaging of proteins...instead of a two-component system (Figure 9C) SAM activators - co-expression of dCas9-VP64 with a modified...

  11. Modular Cloning Guide

    Type
    Guide
    ...basic parts (promoters, UTRs, coding sequences, terminators, etc.) flanked by fusion sites into individual... signal peptide, a protein-coding gene, and a terminator, as in Figure 1). Next, up to six Level 1 modules...Daniel Voytas 93 additional plasmids including regulatory elements, coding sequences, CRISPR parts GreenGate... vectors specific for tobacco ( N. tabacum ) or potato ( S. tuberosum ). Joint Modular Cloning (JMC) Toolkit...expression, RBS strength variants, synthetic terminators, protein purification tags and fluorescence proteins...tag-compatible RBSs, 2 secretion tags, 6 CDSs, 9 terminators, 4 nonfunctional "dummy" parts, 34 backbones,...protocols for rapid one-pot, multipart assembly, combinatorial design and expression tuning in E. coli . CIDAR...

  12. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...Link opens in a new window) together with the laboratory of NeuroMab Director, Dr. James Trimmer, have...

  13. Sequencing Primers

    Type
    Guide
    ...forward primer tdTomato-Fwd CTGTTCCTGTACGGCATGG 3' end of tdTomato, forward primer tdTomato-Rev TCTTTGATGACGGCCATGT...GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC ...TAGAAGGCACAGTCGAGG (Invitrogen) Bovine growth hormone terminator, reverse primer Bglob-intron-F CTGGTCATCATCCTGCCTTT... GTGGTTTGTCCAAACTCATC (Invitrogen) SV40 polyA terminator, reverse primer Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC...hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC ...Reverse GAGTCACTTTAAAATTTGTATACAC (Invitrogen) ADH terminator, reverse primer pLTet-F ACTGAGCACATCAGCAGGAC ...forward primer T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator, reverse primer Tac promoter GAGCGGATAACAATTTCACACAGG...

  14. Lentivirus Production

    Type
    Protocol
    ...1000 µL single channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container pH ...

  15. Lentiviral Vector Guide

    Type
    Guide
    ...lentiviral vectors that can be safely used in laboratory settings. These engineered lentiviral vectors...single strand of RNA contains packaging genes, regulatory genes, accessory genes, and the long-terminal...are necessary for lentiviral production in the laboratory, and many have been removed or mutated for increased...Wild-type lentiviruses additionally require the regulatory genes tat and rev , along with virus-specific... genome. To produce lentiviral vectors in the laboratory, the non-required components have been removed... — contains packaging genes gag and pol , and regulatory genes tat and rev ; separated into two plasmids...plasmid — contains entire viral genome (packaging, regulatory, and accessory genes), only envelope removed ...

  16. Optogenetics Guide

    Type
    Guide
    ...signals; e.g., calcium indicators In this overview, we will focus on the common actuators used in optogenetics...classified based on their functions into two groups: Actuators are genetically-encoded tools for light-activated...physiological pH and trafficks well to the membrane. Excitatory (Depolarizing) ChR Variants. The optogenetic ...experiment? Depending on your answer, you’d pick an excitatory or inhibitory opsin, respectively. Color of activation...domains bPAC Light-activated adenylyl cyclase from Beggiatoa sp. for light-induced cAMP modulation. Utilizes...plasmids rely on the engineered two-component regulatory system YF1/FixJ. YF1 is a synthetic, photosensitive...chromophore, and phosphorylates the transcriptional activator FixJ in the absence of blue light. 470 Fluorescent...

  19. Western Blot

    Type
    Protocol
    ...the Top Stack to one side and discard the white separator. Keep the Bottom Stack in the plastic tray. Place...

  20. Chemogenetics Guide

    Type
    Guide
    ... Experiment References Chemogenetic tools are actuators for specific cellular pathways, receptors, or ...of ion channels arePharmacologically Selective Actuator Modules (PSAMs, pronounced SAMs). PSAMs are engineered...Depending on your answer, you’d pick a chemogenetic activator or inhibitor, respectively. DREADDs or PSAMs or...delivery. Chemogenetic ligand. The chemogenetic actuator chosen and the context of the experiment will ...such as DCZ versus CNO. Delivery. Chemogenetic actuators are delivered in vivo through viral injection ...Selective Modulation of cAMP Production in Striatopallidal Neurons. Neuropsychopharmacol. 38:854–862. ...Deschloroclozapine, a potent and selective chemogenetic actuator enables rapid neuronal and behavioral modulations...
Showing: 621 - 640 of 648 results