We narrowed to 81 results for: ALP

...Matrix Adhesions 87421 TUBA1B-mEGFP AICSDP-4 mEGFP Alpha-tubulin Microtubules 87422 LMNB1-mEGFP AICSDP-10...Peroxisomes 101785 TUBA1B-mTagRFP-T AICSDP-28 mTagRFP-T Alpha-tubulin Microtubules 101786 ST6GAL1-mEGFP AICSDP...Transcription Factor 124607 ACTN2-mEGFP AICSDP-63 mEGFP Alpha-actinin-2 Sarcomeric z-disks 124608 NPM1-mTagRFP-T...

...PRKM8, SAPK1, SAPK1c MAPK9 JNK-55, JNK2, JNK2A, JNK2ALPHA, JNK2B, JNK2BETA, PRKM9... PRKM15, RK, SAPK2A, p38, p38ALPHA MAPK15 ERK7, ERK8 *Image is licensed under the...

...13421 pAC-Kan-alphaGal4 13422 pBAC-lacZ 13424 KJBAC1 strain 21869 pKJ1267 (aka pAC-alphaGal4) 21870 pKJ1712...

...Blog Genome Engineering SynBio Depositing Labs Hal Alper J. Chris Anderson Adam Arkin Gabor Balazsi Matthew... Mammalian Plant Algal Featured SynBio Deposits Alper Lab Y. Lipolytica Promoters Anderson Lab Plasmids...

... of mechanotransduction receptors, comprised of alpha-beta subunit heterodimers. The IPI collection contains...contains antibodies that uniquely: Bind to the alpha subunit, outside the ligand-binding pocket Bind to...

...ligation reaction into competent cells such as DH5alpha or TOP10. If using much less total DNA (<1ng...

... PPP1CA Protein phosphatase 1 catalytic subunit alpha PREX2 Phosphatidylinositol-3,4,5-trisphosphate-dependent... kinase AMP-activated: A1,A2: Catalytic subunit alpha B1,B2: non-catalytic subunit beta G1, G2, G3: non-catalytic...

...ligation reaction into competent cells such as DH5alpha or TOP10. If using much less total DNA (<1ng) ...

...Rtn4a-GFP (tubular ER) Microtubules mCherry-alpha-tubulin Early Endosome Vacuolar Compartment...

...modifications: replacement of the Cbh promoter with EF1alpha addition of an mCherry reporter variant nuclear...

...catalytic and regulatory subunits - Class I PKC PKC alpha PKC beta PKC delta PKC epsilon PKC gamma PKC eta...

...GADD45G Growth arrest and DNA-damage-inducible; alpha, beta, or gamma IGF-BP3 Insulin-like growth factor...

...-shRNA3 72598 Expresses shRNA against mouse TNF-alpha mRNA from the mouse U6 promoter pCDH-EF1-Nluc-P2A-copGFP-T2A-Puro...

...Drosophila 165580 pOpen-BovDNTT Bovine DNTT 165555 pOpen-ALPI CIP (calf intestinal phosphatase) Return to top ...

...al. Neuron. 2010) Express EGFP-tagged wt and mt Alpha-synuclein . (Furlong et al. Biochem J. 2000) See...

...Acid Linkers between a Fluorescent Protein and PDE5alpha. ACS Sens. 2017 Jan 27;2(1):46-51. Tetsuya Kitaguchi...

...Drosophila Actin 5C promoer Forward Alpha-factor TACTATTGCCAGCATTGCTGC Alpha factor signal sequence Forward... Reverse XEF1a TTTCGCCCTAACTTCGTGAT Xenopus EF1 alpha enhancer/promoter Forward Xpress Forward TATGGCTAGCATGACTGGT...

... common lab strains MG1655 and its derivatives DH5alpha and DH10b (also known as TOP10) among others, ...lacY1 proA2 rpsL20(StrR) xyl5 lambda- leu mtl1 DH5alpha Invitrogen F- Phi80lacZΔM15 Δ(lacZYA-argF) U169...

...790. PMID: 38216671 Klompe, S. E., Vo, P. L. H., Halpin-Healy, T. S., & Sternberg, S. H. (2019). Transposon-encoded...

... Strong promoter from human elongation factor 1 alpha PGK Constitutive Mammalian Promoter from phospholycerate...