Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 976 results for: nin

Showing: 961 - 976 of 976 results

  1. Optogenetics Guide

    Type
    Guide
    ...manipulate cells (frequently neurons) and their governing biomolecular processes with light. Read this guide... by light, these channels and pumps respond by opening or closing, which conducts the flow of ions into...precise spatiotemporal control of these neurons by turning on and off the light source. Optogenetics has been....1 540 Plan Your Optogenetics Experiment When designing your optogenetics experiment, you'll need to pick...light-inducible dimerization tags (TULIPs), plasmids allow cloning of protein coding sequences with GFP-LOVpep, cpPDZ...Sørensen, A. T., Young, A., Klapoetke, N. C., Henninger, M. A., Kodandaramaiah, S. B., Ogawa, M., Ramanlal...Tye, K. M., Roska, B., … Boyden, E. S. (2014). Noninvasive optical inhibition with a red-shifted microbial...

  2. Using a Light Microscope Protocol

    Type
    Protocol
    ...adjustments to the focus. After you are happy with the positioning and focus of your image on the lowest magnification...focus. Increase the power of the light source by opening the diaphragm so that you can easily see your sample...

  3. Antibody Guide

    Type
    Guide
    ...antibodies. Recombinant antibodies are created by cloning antibody genes from specific hybridoma cells into... two types of antigen specificity: monoclonal, meaning many copies of one clone that are specific to a... a certain epitope, or polyclonal, meaning there are many clones that are specific to multiple epitopes...using permeabilization, antigen retrieval, and/or sectioning. Block to reduce non-specific binding of antibodies...panels used currently are in the mid-forties. When designing a multiplex assay, selection of the fluorophores... your target epitope in the assay type you are running. Sufficient validation data specific to your antibody...Validation of an antibody is a process separate from running appropriate controls in your assay. There are five...

  4. Antibody Validation Using the Indirect ELISA Method

    Type
    Protocol
    ...isotype-specific secondary antibody ELISA 96-well microplate, Corning 9018 Bovine serum albumin (BSA), VWR 10273-264 ..., 10 mL, VWR 89130-898 1 L polystyrene bottle, Corning 430518 PBS, 1X pH 7.4, VWR 45000-446 TMB (3,3',...

  5. AAV ddPCR Titration

    Type
    Protocol
    ... pipettes and surfaces with 10% bleach. Safety Warnings AAV is generally considered biosafety level 1 ...FAM-CACTCCCTCTCTGCGCGCTCG-BBQ- Reagent Preparation 1X PCR Buffer containing 0.05% Poloxamer 188: Prepare immediately before...

  6. Educational Resources

    Type
    Guide
    ...plasmid cloning, and virus, including: Gel Electrophoresis Bacterial Transformation Plasmid Cloning Creating...Plasmid? Genetic Code Strain Information Molecular Cloning Techniques Protocols Find written and video protocols...

  7. Science Guides

    Type
    Guide
    ...created the following guides to help you start learning about various scientific concepts related to our...background information on CRISPR and the basics for planning your first CRISPR experiment. Read More Optogenetics...manipulate cells (frequently neurons) and their governing biomolecular processes. The tools and technologies...

  8. Addgene's eBook Collection

    Type
    Guide
    ...experimental advice such as tips for planning your CRISPR experiment and designing your gRNA and how to use pooled...nomenclature, and uses to common promoters and cloning techniques! Close About Overlay Select CRISPR 101...

  9. DNA Quantification

    Type
    Protocol
    ...Information During several different stages of molecular cloning, it is important to get a quick and accurate reading...

  10. Chemogenetics Guide

    Type
    Guide
    ...PSAM-5HT3 LGICs pair a PSAM domain with a 5-HT 3 serotonin receptor sodium- or potassium-selective IPD. Binding..., 2025 Plan Your Chemogenetics Experiment When planning your chemogenetics experiment, here are some things...

  12. Protocol - How to Streak a Plate

    Type
    Protocol
    ...check this before incubating your plate. In the morning, single colonies should be visible. A single colony...

  15. Kit Free RNA Extraction

    Type
    Protocol
    ...to read the SDS (Safety Data Sheet) for safety warnings and hazards for these reagents. Work in a well-ventilated...

  16. Sequencing Primers

    Type
    Guide
    ...origin Forward pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector Forward pBABE...
Showing: 961 - 976 of 976 results