Skip to main content
Addgene
Showing: 961 - 975 of 975 results
  1. CRISPR Guide

    Type
    Guide
    .... P., White, M. F., Yakunin, A. F., Garrett, R. A., Van Der Oost, J., . . . Koonin, E. V. (2015). An updated...in your lab, from knockouts to pooled library screening. Science...CRISPR Basics Small Edits Large Edits Genome-Wide Screening Cas9 Fusion Tools Cas9 Alternatives Resources ...the efficient but error-prone non-homologous end joining (NHEJ) pathway and the less efficient but high-... , and increases the likelihood that any cell containing the CRISPR plasmid will have all desired genomic...researchers to target anywhere from 2–7 genetic loci by cloning multiple gRNAs into a single plasmid — though some...coding sequence ~1 kb shorter than SpCas9 while retaining the same basic function. Its size allows it to...
  2. Lentiviral Guide

    Type
    Guide
    ...appropriate for varied cell types and systems. When planning your experiment, the important component to consider...change and a brief incubation period, supernatant containing the virus is removed and stored or centrifuged...versa. Which bacterial strain should be used for cloning and producing my lentiviral plasmids? Due to the...However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB survival strain is necessary...species and cell types. For more information, see the Cronin, et al. article on different envelopes and their... to clone an insert into a lentiviral plasmid containing only one restriction site? If a lentiviral transfer... single restriction site, one can use standard cloning techniques to ligate the insert into this site....
  3. Plan Your Experiment

    Type
    Guide
    ...should sequence the region you are planning to modify prior to designing your gRNA, as sequence variation... into plasmids containing the gRNA scaffold using standard restriction-ligation cloning. However, the ...amplification of targeted region from DNA, subcloning into a plasmid, and screening individual clones. PCR amplification...sequence. For example, gRNA targeting sequences containing a G nucleotide at position 20 (1 bp upstream ...of the PAM) may be more efficacious than gRNAs containing a C nucleotide at the same position in spite ...design software ). Additionally, many plasmids containing validated gRNAs are now available through Addgene...the exact cloning strategy will depend on the gRNA vector you have chosen, so it is best to review the protocol...
  4. Guide to Using Pooled Libraries

    Type
    Guide
    ...represent a powerful tool for forward genetic screening, or identifying previously unknown genes that ...the Moffat lab has over 175,000 different gRNA-containing plasmids). Amplifying and Using the Library Once...and resistance to to the nucleotide analog 6-thioguanine . Next-generation sequencing is the only way ...that you have access to this technology if you’re planning to conduct a pooled library screen. The figure...used. Below are the general steps to take in the screening process. Amplify the library (electroporation ...pass selection (in the case of a reporter) Sort “winning” cells Sequence those cells that pass (“win”) Get...CRISPR guide for more information on genome-wide screening with CRISPR/Cas9 . Browse our Viral Vector resources...
  5. Optogenetics Guide

    Type
    Guide
    ...Young A, Klapoetke NC, Henninger MA, Kodandaramaiah SB, et al. 2014. Noninvasive optical inhibition with...manipulate cells (frequently neurons) and their governing biomolecular processes. The tools and technologies... by light, these channels and pumps respond by opening or closing, which conducts the flow of ions into...precise spatiotemporal control of these neurons by turning on and off the light source. Optogenetics has been....1 540 Plan Your Optogenetics Experiment When designing your optogenetics experiment, you’ll need to pick...light-inducible dimerization tags (TULIPs), plasmids allow cloning of protein coding sequences with GFP-LOVpep, cpPDZ...
  6. Antibody Guide

    Type
    Guide
    ...antibodies. Recombinant antibodies are created by cloning antibody genes from specific hybridoma cells into... two types of antigen specificity: monoclonal, meaning many copies of one clone that are specific to a... a certain epitope, or polyclonal, meaning there are many clones that are specific to multiple epitopes...using permeabilization, antigen retrieval, and/or sectioning. Block to reduce non-specific binding of antibodies...panels used currently are in the mid-forties. When designing a multiplex assay, selection of the fluorophores... your target epitope in the assay type you are running. Sufficient validation data specific to your antibody...Validation of an antibody is a process separate from running appropriate controls in your assay. There are five...
  7. Retrovirus Guide

    Type
    Guide
    ...example: pLXSN has the wild type L TR, an MCS for cloning X gene, an S V40 promoter, and N eomycin selection...structural protein of the retroviral particle containing Matrix, Capsid, and Nucleocapsid components. .... Pol in trans Precursor protein containing Reverse Transcriptase and Integrase components. Transfer cPPT...either side of a retroviral provirus (see below). Cloning capacity between the LTRs is ∼8.5kb, but inserts... The transcript begins, by definition, at the beginning of R, is capped, and proceeds through U5 and the...
  8. Adenovirus Guide

    Type
    Guide
    ...BJ5183 E. coli cells containing pAdEasy™. pAdEasy™ is a ∼33Kb adenoviral plasmid containing the adenoviral ...linear, 36-Kb double-stranded DNA (dsDNA) molecule containing multiple, heavily spliced transcripts. At either...inserts AdEasier-1 cells BJ5183 E. coli cells containing the pAdEasy-1 packaging plasmid 911E4 cells Cell...
  9. Educational Resources

    Type
    Guide
    ...plasmid cloning, and virus, including: Gel Electrophoresis Bacterial Transformation Plasmid Cloning Creating...Plasmid? Genetic Code Strain Information Molecular Cloning Techniques Protocols Find written and video protocols...
  10. Science Guides

    Type
    Guide
    ...created the following guides to help you start learning about various scientific concepts related to our...background information on CRISPR and the basics for planning your first CRISPR experiment. Read More Optogenetics...manipulate cells (frequently neurons) and their governing biomolecular processes. The tools and technologies...
  11. Addgene's eBook Collection

    Type
    Guide
    ...experimental advice such as tips for planning your CRISPR experiment and designing your gRNA and how to use pooled...nomenclature, and uses to common promoters and cloning techniques! Close About Overlay Select CRISPR 101...
  12. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...to Rep and Cap, AAV requires a helper plasmid containing genes from adenovirus. These genes (E4, E2a and...to find plasmids optimized for use in AAV, or containing Staphylococcus aureus (SaCas9) . AAV is also ...using a slash, so that AAV2/5 indicates a virus containing the genome of serotype 2 packaged in the capsid...
  13. Chemogenetics Guide

    Type
    Guide
    ...Chemogenetic Receptors: RASSLs DREADDs PSAMs LMOs Planning Your Experiment References Chemogenetic tools ...PSAM-5HT3 LGICs pair a PSAM domain with a 5-HT 3 serotonin receptor sodium- or potassium-selective IPD. Binding... Browse Addgene's collection of LMO plasmids ! Planning Your Chemogenetics Experiment If you're starting...
  14. Promoters

    Type
    Guide
    ...RNA expression UAS Specific Drosophila promoter containing Gal4 binding sites Bacterial Promoters Promoters...
  15. Sequencing Primers

    Type
    Guide
    ...forward primer pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC...
Showing: 961 - 975 of 975 results