...Renilla GFP), forward primer hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter, forward primer...

...distinct IgG subclass from the conventional mAb to facilitate multiplex labeling with subclass-specific secondary...References Andrews NP, et al. 2019. A toolbox of IgG subclass-switched recombinant monoclonal antibodies for...

...Fluorescent Protein Resources: Empty Backbones FRET Subcellular localization Biosensors Optogenetics Background...

...Fluorescent Protein Resources: Empty Backbones FRET Subcellular localization Optogenetics The lab of Michael ...

...that affect signalling pathways within cells. Subcellular Localization Determine where your protein of ...

...Fluorescent Protein Resources: Empty Backbones FRET Subcellular localization Optogenetics Background In vivo ...

...channel). The Guler lab optimized the actuator’s subcellular localization using trafficking signals and named...

...species (e.g., human, watermelon, Streptomyces ) Subcellular compartment (chloroplastic, cytoplasmic, glyoxysomal...

...CRISPR Protein Tagging Fluorescent Protein Guide Subcellular Localization Background Plasmids Protocols Background...

...GRF4-GIF1 for wheat and other monocots - Jorge Dubcovsky. Engineered biocontainable RNA virus vectors for...

...of fluorescent proteins, including Markers of Subcellular Localization, Optogenetics Plasmids, and Chemogenetics...

...expression of fluorescent TAL effectors to visualize subcellular positioning of target DNA sequences in living...

...expression; puro resistance Sabatini 14883 FUGW 3rd hUbC-driven EGFP; can be used for cDNA expression Baltimore...

...whether the edit was successful. PCR amplification, subcloning and Sanger sequencing (for HDR or NHEJ): Provides...PCR amplification of targeted region from DNA, subcloning into a plasmid, and screening individual clones...

...Fluorescent Protein Resources: FRET Biosensors Subcellular localization Michael Davidson Collection Blog...

... Mammalian U6 none S. aureus Joung pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Puro 71236 Mammalian/Lentiviral hU6...

...antibodies can be isotype-specific or even isotype subclass-specific. This specificity can be used to ensure...Isotype Description Configuration and Valency Subclasses IgA Prevalent antibody in secretions (e.g. tears...should never be stored below 4 °C. Certain isotype subclasses, such as IgG3, aggregate after thawing and therefore...different species of origin, isotypes, and isotype subclasses of a primary antibody, which becomes the limiting...? You may need to buy isotype-specific or even subclass-specific secondary antibodies to allow for differentiation...

...transgenes via increased nuclear export. LTR Subcomponents: U3 R U5 in cis LTR; Long terminal repeats; ...bigger than ∼3kb are packaged less efficiently. Subcomponents: U3; Unique 3'; region at the 3' end of viral...

...possible approaches to using this site include subcloning or appending compatible restriction sites onto... insert of interest using PCR. The process of subcloning consists of digesting the insert of interest ...

...whether the edit was successful. PCR amplification, subcloning and Sanger sequencing (for HDR or NHEJ): Provides...PCR amplification of targeted region from DNA, subcloning into a plasmid, and screening individual clones...