Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 677 results for: RON

Showing: 51 - 60 of 677 results

  1. Lentivirus Plasmids

    Type
    Collection
    ...transfer plasmids Trono 12259 pMD2.G N/A Envelope VSV-G-expressing envelope plasmid Trono 8454 pCMV-VSV-G...transgene expression, contains intron that gives you high expression. Trono 12254 pWPI 2nd EF-1alpha driven...plasmids along with additional packaging components Trono 63586 psPAX2-D64V 2nd Packaging For making Integrase...transfer plasmids along with a plasmid encoding Rev Trono 12260 psPAX2 2nd Packaging Contains Gag, Pol, Rev...used with 2nd and 3rd generation transfer plasmids Trono 12263 pCMV delta R8.2 2nd Packaging Contains Gag...under the control of a tet-responsive H1 promoter Trono 11651 pLVUT-tTR-KRAB 3rd Inducible expression of...about cloning & additional plasmids. Aebischer and Trono 11795 pLL3.7 3rd Expresses shRNA under mouse U6 ...

  2. AAVED

    Type
    Collection
    ...targeted neuronal manipulation. Topics may include: How this technology is used for targeted neuronal manipulation...Series AAV Technologies and Methods for Targeted Neuronal Manipulation Meeting Date September 21, 2018 Contact... AAV-based molecular tools to achieve targeted neuronal manipulation (aka intersectional control). The...fit in the big picture of methods for targeted neuronal manipulation? Best practices for using this techonology... is presenting on) is used to achieve targeted neuronal manipulation. Figures, tables, data, or images...communication representing a reference for AAV use in neuronal intersectional control. Through your participation...Adeno-Associated Virus Technologies and Methods for Targeted Neuronal Manipulation. Haery L, Deverman BE, Matho KS, ...

  3. Tetracycline Inducible Expression

    Type
    Collection
    ...scientists have adapted an antibiotic resistance operon from E. coli : the tetracycline repressor protein... reversed (Figure 1). However, rtTA can induce stronger expression of the downstream gene via its activation...plasmids. tetR-KRAB TRE Patrick Aebischer , Didier Trono 41393 pCW57.1 Lentiviral Tet-On vector for inducible...Kaufman 175274 pAAV-rtTA AAV Tet-On vector with neuron-specific expression of rtTA3 from hSyn promoter...TRE3GS promoter for conditional auxin-inducible degron system Masato Kanemaki 92099 AAVS1_Puro_Tet3G_3xFLAG_Twin_Strep...plasmid for differentiating iPSCs into glutamatergic neurons via human NGN2 expression. See more from the iPSC...harbor site, for iPSC differentiation into cortical neurons Michael Ward 100798 pAAV-syn-FLEX-splitTVA-EGFP-tTA...

  4. Cre-lox system

    Type
    Collection
    ...pLOX-CW-CRE Cre CMV Lentiviral Trono 12265 pHR-CMV-nlsCRE Cre CMV Lentiviral Trono 12493 p259 pCMV-CRE-M (BglII...newborn neurons Retroviral Luikart 66693 pRubiG-T2A-cre GFP and Cre expression in newborn neurons Retroviral...CREM (or Cre-M) has been engineered to contain an intron, preventing Cre expression when cloning in E. coli...including the polyadenylation site and several introns tet-hCMV Mammalian Sauer 12168 pMB80 (R26-CreER...AAV Aebischer 24704 GFAP-Cre Cre GFAP Mammalian Sofroniew 25997 LV-Cre pLKO.1 Cre and shRNA coexpression...pmSyn1-EBFP-Cre Cre-EBFP fusion; Expression in neurons. synapsin AAV Zeng 51904 paavCAG-iCre iCre CAG ...AAV-hSyn-mCherry-P2A-Cre-WPRE mCherry and Cre; expressed in neurons hSyn AAV Yang 107313 AAV-aCamkII-mCherry-P2A-Cre-WPRE-BGH-polyA...

  5. Luciferase Plasmid Collection

    Type
    Collection
    ...Biology CMV-LUC2CP/intron/ARE, CMV-LUC2CP/ARE : A splicing reporter that contains an intron in the middle ...expression constructs available that are driven by a strong constitutive promoter and can be used to monitor...so both Renilla and Firefly luciferase contain introns Anthony Leung 141285 pGWB401NL3F10H NanoLuc® Creation...Top Expression Constructs Luciferase driven by a strong constitutive promoter and can be used to monitor...firefly luciferase Scott Lowe 14080 pAKlux2 Lux Operon Bacterial expression of luciferase from broad host...expression of firefly luciferase and iRFP720 from a bicistronic promoter Antonius Plagge 118017 pLX313-Firefly...

  6. Biosensor AAV Preps

    Type
    Collection
    ...Boyden Voltage Reporter: Voltron 119036 pAAV-hsyn-flex-Voltron-ST Syn Voltron-ST none Cre dependent 1 ...Oxytocin (OT) Sensors GRAB_OT Voltage Sensors Archon Voltron JEDI-2P ATP Sensors iATPSnFR2 5-HT Sensors GRAB...pAAV-hSynapsin1-axon-GCaMP6s-P2A-mRuby3 Syn axon-GCaMP6s bicistronic mRuby3 Constitutive 5, 9 Tian 112010 pAAV-hSynapsin1...Schreiter 172907 pGP-AAV-syn-FLEX-Volton2-ST-WPRE Syn Voltron2-ST none Cre dependent 1 GENIE Voltage Reporter...

  7. Validated gRNA Sequences

    Type
    Collection
    ...26616834 Patron lC.GA4a B. oleracea GTTTTCACTTGCGGCCGGAG 68255 cut S. pyogenes 26616834 Patron leu2 S. ... 26616834 Patron PM19 H. vulgare GGCTGGCGTTGGTCGTAACA 68254 cut S. pyogenes 26616834 Patron Prnp M. musculus...59724 cut S. pyogenes 25543152 Hanna BT1754 B. thetaiotaomicron GAAAATGGGGTGTATCCTGC 68892 interfere S. pyogenes...pyogenes 26918244 Lu BT1854 B. thetaiotaomicron ATTGAAGAACAAAAGCAGTT 68891 interfere S. pyogenes 26918244...

  8. Structural Genomics Consortium Plasmids

    Type
    Collection
    ...//www.thesgc.org/ SGC Toronto: https://www.thesgc.org/scientists/groups/toronto SGC Oxford: http://www.sgc.ox.ac.uk...without restriction. Many SGC plasmids from the Toronto, Oxford and Stockholm sites have been deposited...the SGC plasmid collection by All Plasmids SGC Toronto SGC Oxford SGC Stockholm Bacterial Expression Plasmids...

  9. Optogenetics Plasmid Collection

    Type
    Collection
    ...specific neurons, often utilizing viral expression systems, to activate or deactivate these neurons in a .... When using these opsins as a tool to control neuronal activity, scientists generally attach a fluorescent... table below for the optogenetics plasmids for neuronal excitation and inhibition. For example, search...

  10. Antibody Guide

    Type
    Collection
    ... more expensive than polyclonal antibodies. Environmental factors, binding partners, location in the cell...antigen. Polyclonal antibodies are often more environmentally stable and more cost-effective. They are useful...are synthetic binding proteins which use the Fibronectin type III domain as their scaffolding instead ...does not use cross-linking and instead relies on strong interactions between DNA and protein. Micrococcal...for DNA:histone modifier interactions, which have strong binding between the protein and DNA. Some ChIP ...different antibodies and do batch validation up front rather than risk delaying a process through sequential...
Showing: 51 - 60 of 677 results