We narrowed to 938 results for: Kin
-
TypeCollection...Link opens in a new window) Don’t See What You’re Looking For? Our Packaged on Request service offers you...
-
Biosensor AAV Preps
TypeCollection...Retrograde AAV Inventory Page . Don’t See What You’re Looking For? Our Packaged on Request service offers you... -
Optogenetics Guide
TypeGuide...mutations to alter the absorption spectrum or adding trafficking signals to localize opsins to the cell membrane...research, helping scientists to better understand Parkinson’s disease, depression, drug addiction, and more...), C1V1(t/t), ChIEF Increased channel (on/off) kinetics: Examples: ChETA, C1V1(t/t), ChrimsonR Red-shifted...CrChR2 450 ChETA E123T mutation; creates faster kinetics but reduces photocurrent amplitude 490 ChR/T159C...activity 589 eNpHR 3.0 NpHR with addition of trafficking signal from Kir2.1 and ER export signal provide...sodomense 566 eArch 3.0 Arch with addition of trafficking signal from Kir2.1 566 ArchT Light-activated ... Arch. 566 eArchT 3.0 ArchT with addition of trafficking signal from Kir2.1 566 Leptosphaeria rhodopsins... -
Molecular Biology Reference
TypeGuide...Origins of Molecular Genetics Plasmid Elements Working with Plasmids Introduction Types of Plasmids E....to break chromosomes down to study their genes, marking the birth of molecular genetics. Today, scientists...primers check out Addgene's sequencing primer list. Working with Plasmids Plasmids have become an essential...entry vectors and TOPO cloning vectors. If you are looking for an empty plasmid backbone for your experiment... number of E. coli strains below and recommend checking out these two Addgene blog posts relating to common...and their recommended concentrations. We suggest checking your plasmid's datasheet or the plasmid map to...Antibiotic Recommended Stock Concentration Recommended Working Concentration Ampicillin 100 mg/mL 100 µg/mL Carbenicillin... -
CRISPR Guide
TypeGuide...dynamic tracking of repetitive and non-repetitive genomic loci, chromosome painting, and RNA tracking in living... the most scalable genome editing technologies, making CRISPR perfect for genome-wide screens. This guide...very close proximity to the region to be edited, making the PAM sequence (NGG) limiting. This PAM is abundant...inhibit CRISPR by a variety of mechanisms, including blocking crRNA loading or PAM recognition; inhibiting Cas9...sites is sufficient to repress transcription by blocking initiation. More robust transcriptional repression...repression through cytosine methylation with improved kinetics LSD1 - repression through targeted removal of ...proteins that target RNA instead of DNA enables tracking of RNA in live cells, including orthogonal RNA... -
Chemogenetics Guide
TypeGuide...exhibited high levels of constitutive activity, making them less than ideal. DREADDs Designer Receptors... previously used in human populations in Japan, making it an attractive option for translational studies...engineered to respond specifically to the anti-smoking drug varenicline. This PSAM carries mutations at... workflows (such as laser or LED illumination), making LMOs a versatile option. Coupling brighter bioluminescent...antipsychotic drugs: is M1 agonism a pre-requisite for mimicking clozapine’s actions? Psychopharmacology. 178:451...opens in a new window) Slaviero AN, Gorantla N, Simkins J, Crespo EL, Ikefuama EC, Tree MO, Prakash M, ... -
Adenovirus Guide
TypeGuide...necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular Biology...response in different ways, such as expressing cytokines and other immune-modulatory molecules. Another...occur with contact to mucous membranes or broken skin. The risk of exposure and reaction severity is increased... He, T. C., Zhou, S., da Costa, L. T., Yu, J., Kinzler, K. W., & Vogelstein, B. (1998). A simplified system... J., Sharff, K. A., Luu, H. H., Haydon, R. C., Kinzler, K. W., Vogelstein, B., & He, T. C. (2007). A protocol... -
Antibody Guide
TypeGuide...important factor (for instance, looking for a different conjugate or looking for antibodies validated for...unused surface-binding sites in the wells with a blocking protein such as BSA, followed by several wash ... assay, called native ChIP, does not use cross-linking and instead relies on strong interactions between...the product information for similar antibodies, looking for ones that have identical features and epitopes... -
Plan Your Experiment
TypeGuide...setting up CRISPR experiments. We will focus on making single edits using CRISPR/Cas9 in mammalian cells...experiments and can be used as positive controls when working out a new protocol. Read more about how to design... the cell type. Before proceeding, we recommend asking labmates/colleagues, searching the literature, ...efficiency. Edit Type The type of edit you are looking for will ultimately depend on which CRISPR method... -
Adeno-associated virus (AAV) Guide
TypeGuide...necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular Biology...choice for the delivery of CRISPR/Cas9 elements, making it one of the most common methods for in vivo CRISPR-based...occur with contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points...pioneering solutions for human genetic diseases . Cytokine & Growth Factor Reviews, 80 , 109–120. https:/... -
Sequencing Primers
TypeGuide...promoter, forward primer pcDL-F GTTGCCTTTACTTCTAGGCCT (Kinet lab) 5' of EcoRI site in pcDL vector, forward primer...reverse primer TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA, reverse primer Tn7-end GGGGTGGAAATGGAGTTTTT...TATGGCTAGCATGACTGGT (Invitrogen) Xpress epitope, forward primer Looking for Primers? The primer sequences listed are provided... -
Cloning
TypeGuide... The entry clone now has recombined attL sites flanking your DNA fragment of interest. Now that your DNA...site-specific recombination or a ligation step, making it an easy, cheap and rapid cloning method. So ... -
Gamma-Retroviral Vector Guide
TypeGuide...necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular Biology...occur with contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points... -
Lentiviral Vector Guide
TypeGuide...necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular Biology...occur with contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points... -
Promoters
TypeGuide...Constitutive Mammalian promoter from phospholycerate kinase gene TRE Inducible Tetracycline response element... -
Modular Cloning Guide
TypeGuide...integrative or self-replicating plasmid vectors for working in cyanobacteria. Cultivarium POSSUM Toolkit Bacterial... -
Immunocytochemistry
TypeProtocol...PBS on a rocking platform. Permeabilize cells for 10 min at room temperature ( RT ) on a rocking platform...PBS on a rocking platform. Section 3: Labeling with antibody Block for 20 min at RT on a rocking platform...platform in 500 µL blocking buffer. Remove the blocking buffer and dispose of it in an appropriate waste container...PBS on a rocking platform. (Optional) Counterstain nuclei with 500 µL of 300 nM DAPI working solution ...Equipment Pipette controller Pipette tips and pipettes Rocking platform Tweezers Fluorescent microscope 0.5–10...buffer: Dilute 20 µL of Triton X-100 in 10 mL PBS. Blocking buffer: Dilute 0.5 g BSA and 30 µL Triton X-100... 150 µL Triton X-100 in 50 mL PBS. 300 nM DAPI working solution: Prepare a 300 µM DAPI stock solution ... -
Western Blot
TypeProtocol...side up. Block the membrane in blocking buffer for 1 h at RT on a shaking platform. Wash the membrane 3x... at RT on a shaking platform. Wash the membrane 3x for 5 min in 1X TBST at RT on a shaking platform. Prepare...information specific to your antibody, such as ideal blocking buffer and optimal antibody concentrations. Consider...When the run is complete, select Done. Section 5: Blocking Prepare 1X TBST as follows: 25 mL of 20X TBS 2.5...20 472.5 mL of deionized water Mix well Prepare blocking buffer as follows: Dilute 5% w/v non-fat milk ...milk into 100 mL of 1X TBST. Pro-Tip The ideal blocking buffer will vary between antibodies. Refer to ... 3x for 5 min in 1X TBST at RT on a shaking platform. Section 6: Antibody incubation Dilute the primary... -
Lab Safety for Biosafety Levels One and Two
TypeProtocol... some times when you may be working with a protocol that requires shaking or mixing, which may produce...safety guidelines provide steps to ensure you are working in BSL-1 and BSL-2 labs safely. Protocols...safety requirements. BSL-1 is designated for those working with microbes that don’t cause disease in healthy...equipment (PPE) and wear it the whole time you are working in the lab. Do not eat, drink, chew gum, or apply...work at your lab bench. It’s possible that while working, you may accidentally come into contact with hazardous...into your eyes. Wash your hands before and after working in the lab. Ensure that a designated chemical waste...safety training before starting the work. Before working with chemicals, first review their material safety... -
Video Library
TypeProtocol...Protocol Streaking Bacteria on Plates Isolate single bacterial colonies on an agar plate Streaking Bacteria...new window) Video Link Description Related Page Making LB Agar Plates Create plates to culture bacteria...Started with Tissue Culture Tips and tricks for working with tissue culture in the lab. Blog post: 10 Basic...clean workspace, and maintaining sterility while working. AAV Titration by qPCR Use qPCR to measure the ...students considering their future careers. Eric J. Perkins, PhD In this installment, we sit down with Senior...Senior Scientific Project Leader Eric Perkins to discuss the various positions he has held in his career...the works, and all of the things she loves about working at Addgene! Maria Soriano Maria Soriano, from Addgene's...