Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 185 results for: INV-E

Showing: 161 - 180 of 185 results

  1. Chemogenetics Plasmids

    Type
    Collection
    ...this list? Fill out our Suggest a Plasmid form or e-mail [email protected] to help us improve this resource...chemogenetic resources available at Addgene. See our inventory of chemogenetic constructs, including DREADD constructs...

  2. Plan Your Experiment

    Type
    Collection
    ...Horlbeck, M. A., Adamson, B., Villalta, J. E., Chen, Y., Whitehead, E. H., Guimaraes, C., Panning, B., Ploegh...Raychowdhury, R., Adamson, B., Norman, T. M., Lander, E. S., Weissman, J. S., Friedman, N., & Regev, A. (2016...10.1016/j.tibtech.2017.11.006 PMID: 25307932 Hanna, R. E., & Doench, J. G. (2020). Design and analysis of CRISPR–Cas...methods is RNA delivery of Cas and gRNA. This method involves using in vitro transcription reactions to generate...

  3. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...reaction (see step 3.2 ). Transform 10 μl of DH5α E. coli cells with 1 μl of reaction (from 3.2.1 - 3.2.2...a plasmid vector. Transform the plasmid into DH5α E. coli cells and plate onto LB agar plates with the...2007. PubMed . Transformation of plasmid DNA into E. coli using the heat shock method. Froger...CRISPRs into Cells of Interest NOTE: This protocol involves the delivery of CRISPR/Cas9 plasmids by electroporation...

  4. Adenovirus Plasmids

    Type
    Collection
    ...this list? Fill out our Suggest a Plasmid form or e-mail [email protected] to help us improve this resource...produced by several methods, the most common of which involves homologous recombination of adenovirus plasmids...

  5. Promega Plasmid Collection

    Type
    Collection
    ... for various protein expression systems including E. coli , mammalian cells, and cell-free systems. HiBiT...real-time monitoring of signaling pathways, investigating RNA regulation, tracking protein degradation...

  6. Cre-lox system

    Type
    Collection
    ...intron, preventing Cre expression when cloning in E. coli . This alteration enables the generation of ...construct (unmodified Cre will cause recombination in E. coli , deleting the floxed portion of a construct...this list? Fill out our Suggest a Plasmid form or e-mail [email protected] to help us improve this resource...below shows the three types of rearrangements: inversion, deletion, and translocation. Figure 1. Recombination...opposite directions, recombination results in an inversion and the region of DNA between the target sites...binding to these sites can result in excision, inversion or translocation depending on the orientation ...

  7. Ras Pathway

    Type
    Collection
    ...this list? Fill out our Suggest a Plasmid form or e-mail [email protected] to help us improve this resource...variety of pathways, which ultimately turn on genes involved in cell growth, differentiation and survival. ...Transcription factor Dp TIAM TIAM1 TIAM2 T-cell lymphoma invasion and metastasis TP53 Tumor protein p53 TSC TSC1...

  8. Neurodegeneration Research Collection

    Type
    Collection
    ...factors. For example, variations of Apolipoprotein E (APOE), such as the ε4 allele, are a risk factor for...symptoms through medication and surgery. PD primarily involves the malfunction and death of dopamine-producing...other large scale studies. Researchers are now investigating the role that these additional genes may play...

  9. Validated gRNA Sequences

    Type
    Collection
    ...article 60224 cut S. pyogenes 25263330 Zhang LacZ E. coli TGCGAATACGCCCACGCGAT 60225 cut S. pyogenes 25263330...ACTCCAGTCTTTCTAGAAGA 64216 cut S. pyogenes 25803306 Kuhn rpsL E. coli AAAAAACCGAACTCCGCGCTGCGTAAAGTA 44505 cut S. ... Sato inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A....26018130 Xue inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A...

  10. Zebrafish Plasmid Collection

    Type
    Collection
    ...this list? Fill out our Suggest a Plasmid form or e-mail [email protected] to help us improve this resource...to genetics, high-throughput screening and non-invasive live imaging. A standard toolbox of genetic methods...

  11. Viral Production

    Type
    Collection
    ...propagated in the endA -mutated NEB Stable strain of E. coli . In addition, plasmids are typically prepared...correct integrated provirus using PCR. This assay involves transducing cells with serial dilutions of the...

  12. Zhang Lab CRISPR Page

    Type
    Collection
    ...screening in human cells. Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelsen TS, Heckl D, Ebert BL,...) is a microbial nuclease system involved in defense against invading phages and plasmids. CRISPR loci...increase targeting efficiency. These plasmids use the inverted terminal repeats (ITR) from AAV serotype 2. SaCas9...

  13. CRISPR Guide

    Type
    Guide
    ...36593413 Vo, P. L. H., Ronda, C., Klompe, S. E., Chen, E. E., Acree, C., Wang, H. H., & Sternberg, S. H... R., Hanna, R. E., Hegde, M., Donovan, K. F., Strand, C., Sullender, M. E., Vaimberg, E. W., Goodale, ...edits. PASSIGE ( P rime- E diting- A ssisted S ite- S pecific I ntegrase G ene E diting), developed by the.... PMID: 26735016 Lee, J. K., Jeong, E., Lee, J., Jung, M., Shin, E., Kim, Y., Lee, K., Jung, I., Kim, ..., K. M., Aach, J., Guell, M., DiCarlo, J. E., Norville, J. E., & Church, G. M. (2013). RNA-Guided Human...Siouve, E., Becavin, C., Depardieu, F., & Bikard, D. (2018). Genome-wide CRISPR-dCas9 screens in E. coli...e1007749. PMID: 30575746 Shalem, O., Sanjana, N. E., Hartenian, E., Shi, X., Scott, D. A., Mikkelsen, T. S.,...

  14. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Osmolarity SED1 osmolarity biosensor, for expression in E. coli , yeast, or plants Intrinsically disordered ...this list? Fill out our Suggest a Plasmid form or e-mail [email protected] to help us improve this resource... experimental design, biosensors can enable investigation of a signaling pathway or measurement of a biomolecule...2011;6(12):e28245. Uwe Sauer Citrate Direct or inverse fluorescent biosensor for citrate (Citron/Citroff...cytosolic High-Performance Intensiometric Direct- and Inverse-Response Genetically Encoded Biosensors for Citrate...

  15. Molecular Biology Reference

    Type
    Guide
    ...prior to use in an experiment. E. coli strains for propagating plasmids E. coli are gram-negative, rod ...Addgene blog posts relating to common E. coli lab strains and E. coli strains specialized for protein ...BL21 Invitrogen; New England BioLabs E. coli B F dcm ompT hsdS(rB mB) gal ccdB Survival Invitrogen F- mcrA...Working with Plasmids Introduction Types of Plasmids E. coli strains for propagating plasmids Antibiotics...genes. For instance, most plasmids are replicated in E. coli and are relatively small (∼3000 - 6000 basepairs...inserted. When a plasmid exists extrachromosomally in E. coli , it is replicated independently and segregated...are many different naturally occurring strains of E. coli , some of which are deadly to humans. The majority...

  16. Adenovirus Guide

    Type
    Guide
    ..., Pierson, T. C., & Weaver, E. A. (2020). Characterization of a Species E Adenovirus Vector as a Zika ... new window) Lee, C. S., Bishop, E. S., Zhang, R., Yu, X., Farina, E. M., Yan, S., Zhao, C., Zheng, Z....AdEasier-1 cells (Addgene #16399) , which are BJ5183 E. coli cells containing pAdEasy. pAdEasy is a ~33 kb...a new window) Lee, D., Liu, J., Junn, H. J., Lee, E. J., Jeong, K. S., & Seol, D. W. (2019). No more helper...after exposure to an antigen. AdEasier-1 cells BJ5183 E. coli cells containing the pAdEasy-1 packaging plasmid...multiple heavily-spliced transcripts flanked by two inverted terminal repeats (ITRs). Adenoviral genes are ... cargo in first-generation rAdV vectors. E3 is involved in evading host immunity and is not essential ...

  17. Lentiviral Vector Guide

    Type
    Guide
    ....2012.229 PMID: 23311447 Shalem, O., Sanjana, N. E., Hartenian, E., Shi, X., Scott, D. A., Mikkelsen, T. S.,...doi.org/10.3390/v3020132 PMID: 22049307 Ghaleh, H. E. G., Bolandian, M., Dorostkar, R., Jafari, A., & Pour...Edavettal, J. M., Swaminathan, T. A., & Braun, S. E. (2021). HIV-based lentiviral vectors: Origin and ...Sutherland, H., Saenz, D., Bickmore, W., Poeschla, E., & Bushman, F. D. (2007). Role of PSIP1/LEDGF/p75...., Heckl, D., Ebert, B. L., Root, D. E., Doench, J. G., & Zhang, F. (2013). Genome-Scale CRISPR-CAS9 knockout..., Dykxhoorn, D. M., Palliser, D., Mizuno, H., Yu, E. Y., An, D. S., Sabatini, D. M., Chen, I. S., Hahn...transcriptionally active regions, regions recently involved in translocation events, and other “fragile” genomic...

  18. Plan Your Experiment

    Type
    Guide
    ...Horlbeck, M. A., Adamson, B., Villalta, J. E., Chen, Y., Whitehead, E. H., Guimaraes, C., Panning, B., Ploegh...Raychowdhury, R., Adamson, B., Norman, T. M., Lander, E. S., Weissman, J. S., Friedman, N., & Regev, A. (2016...10.1016/j.tibtech.2017.11.006 PMID: 25307932 Hanna, R. E., & Doench, J. G. (2020). Design and analysis of CRISPR–Cas...methods is RNA delivery of Cas and gRNA. This method involves using in vitro transcription reactions to generate...

  19. Sequencing Primers

    Type
    Guide
    ... pBAD Forward ATGCCATAGCATTTTTATCC (Invitrogen) For vectors with E. coli araBAD promoter, forward primer...primer pBAD Reverse GATTTAATCTGTATCAGG (Invitrogen) For vectors with E. coli araBAD promoter, reverse primer...CCCAGTCACGACGTTGTAAAACG (Invitrogen) In lacZ gene M13/pUC Reverse AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene...AAATGATAACCATCTCGC (Invitrogen) Polyhedrin promoter, forward primer Polyhedrin reverse GTCCAAGTTTCCCTG (Invitrogen) For...Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward ...Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse...reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC (Invitrogen) For Pichia vectors with AOX1 promoter, forward...

  20. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...., Deverman, B. E., & Gradinaru, V. (2017). Engineered AAVs for efficient noninvasive gene delivery to...opens in a new window) McCarty, D. M., Monahan, P. E., & Samulski, R. J. (2001). Self-complementary recombinant...Ritola, K. D., Lindo, S., Michael, S., Kuleshova, E., Ojala, D., Huang, C. C., Gerfen, C. R., Schiller...reading frames, Rep and Cap, flanked by two 145 bp inverted terminal repeats (ITRs). The Rep region encodes...proteins (Rep78, Rep68, Rep52, and Rep40), which are involved in genome replication and viral packaging. The...barrier (BBB), and a systemic AAV capsid could avoid invasive methods such as intracranial injection. Systemic...this rate-limiting step, scAAVs contain a dimeric inverted repeat DNA molecule that spontaneously reanneals...
Showing: 161 - 180 of 185 results