Skip to main content
Addgene
Showing: 21 - 40 of 96 results

  1. Tetracycline Inducible Expression

    Type
    Collection
    ...Bacterial systems were tested for functionality in mammalian cells. The lac system with the inducer isopropylthio-β-galactoside... Gossen and Bujard tested the tet system in a mammalian cell system (HeLa) and found that the tet system...rTetR, which reversed the phenotype and created a reliance on the presence of tetracycline for induction,...knockdown of gene expression at a single copy in mammalian cells; Expresses firefly luciferase hairpin and...References Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Gossen...Transcriptional activation by tetracyclines in mammalian cells. Gossen M, Freundlieb S, Bender G, Müller...Tetracycline repressor, tetR, rather than the tetR-mammalian cell transcription factor fusion derivatives, ...

  2. COVID-19 Resources

    Type
    Collection
    ...(SARS classic) sequences. Mammalian Targets : Plasmids containing mammalian sequences linked to SARS-CoV...Return to top Plasmids Encoding Mammalian Genes or Inserts Several mammalian genes have been identified as...protein constructs for making VSV pseudo virus Mammalian constructs Due to the size and complexity of the...cell protein 4) is involved in beating of airway cilia.( 7 ) Cytokines - SARS-CoV-2 infection induces a...Simple, portable, and inexpensive platforms to reliably detect nucleic acids at the atomolar level. For... - Kogiso H, et al, 2020, Int J Mol Sci Airway Ciliary Beating Affected by the Pcp4 Dose-Dependent [Ca...

  3. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...# 1-261) GFP William Bement 26740 mCherry-UtrCH Actin Filaments Utrophin mCherry William Bement 26741 ... ensconsin GFP William Bement 26742 EMTB-mCherry Microtubules ensconsin mCherry William Bement *Fusions...pcDNA3.1-kappa-myc-dL5-2xG4S-TMst Cell surface (mammalian) PDGFR-derived dL5 FAP; mCerulean3 Marcel Bruchez... Voeltz 89472 GFP-hChibby1 Mother Centrioles / Ciliary Base Chibby1 GFP Ken-Ichi Takemaru 89770 pLenti-EGFP-hChibby1...pLenti-EGFP-hChibby1 Mother Centrioles / Ciliary Base Chibby1 EGFP Ken-Ichi Takemaru 118084 pLenti-EB1-EGFP...79990 pKeratin-miRFP703 Intermediate Filaments (epithelial) Keratin miRFP703 Vladislav Verkhusha 79991 pmiRFP703...

  4. CRISPR Plasmids - RNA Targeting

    Type
    Collection
    ... that function in mammalian cells can be used to attentuate RNA levels. In mammalian systems, Cas13a does...available for expression in mammalian systems, bacteria, and plants. Mammalian ID Plasmid Gene/Insert Promoter...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish...

  5. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...jGCaMP8 Fast Genetically Encoded Calcium Indicators. Janelia Research Campus. Online resource. 2020 GENIE Project...tethering by PDZD8 regulates Ca(2+) dynamics in mammalian neurons. Science. 2017 Nov 3;358(6363):623-630...Acetyl-CoA PancACe acetyl-CoA sensor for bacterial or mammalian expression, targeted to nucleus, cytoplasm, or... Fluorescent sensor of cyclic AMP (cAMPr) for mammalian or insect expression (Cre-dependent) cAMPr: A ...extracellular L-lactate, in neurons, astrocytes or mammalian cells A genetically encoded fluorescent biosensor...Serotonin Serotonin sensor iSeroSnFR for bacterial or mammalian expression (Constitutive or Cre-dependent) Directed... pii: S0092-8674(21)00374-3. Lin Tian Serotonin Cilia-targeted serotonin sensor GRAB-HTR6 A serotonergic...

  6. Antibody Plasmid Collection

    Type
    Collection
    ...into plasmids and expressing these in bacteria, mammalian cells, yeast, plants, or insect cells. Benefits...recombinant monoclonal antibodies (R-mAbs) expressed in mammalian cells. Monoclonal antibodies are derived from ...the plasmids are transiently transfected into mammalian tissue culture cells, the R-mAbs are secreted ...antibody heavy- and light-chain DNAs into a single mammalian expression vector A tool kit for rapid cloning...2014 Jul 30;4:5885. Andrew Beavil Cloning and mammalian expression of mouse and human IgG monoclonals ...

  7. Plasmids for Stem Cell Research

    Type
    Collection
    ...Cell. 2019 Jun 6. Buganim Glial Cells Retinal Ganglion Cells AAV/CRISPR Mouse Glia-to-Neuron Conversion by...and Xeno-Free Culture Conditions: A Clinically Compliant Approach. Stem Cells Transl Med. 2015 Mar 5. pii...Precursor Cells Lentiviral Mouse/Rat Generation of oligodendroglial cells by direct lineage conversion. Nat Biotechnol...into cortical and motor neurons. Unpublished. Ward Glial Progenitor Cells GABAergic Interneurons Lentiviral...Human Direct Conversion of Human Stem Cell-Derived Glial Progenitor Cells into GABAergic Interneurons. Cells...

  8. CRISPR Guide

    Type
    Collection
    ...strategy yields C to A base edits, whereas in mammalian cells, it produces C to G edits. Adenine transversion...recombinase with improved integration efficiencies in mammalian cells. PASTE ( P rogrammable A ddition via S ite-specific...not suitable for all cell types or experiments. Mammalian CRISPR libraries have also been created in AAV...that are poorly transduced by lentivirus. Non-mammalian CRISPR libraries are also available, such as those...examples of activation systems to target genes in mammalian cells include: SunTag system - co-expression of...unique to bacterial cells and does not occur in mammalian cells. SHERLOCK , developed by the Feng Zhang ...video reprint: Protocol for genomic deletions in mammalian cell lines Viral service at Addgene Viral plasmids...

  9. CRISPR Plasmids - CRISPR Transposases (CAST)

    Type
    Collection
    ...are available for expression in mammalian systems and bacteria. Mammalian ID Plasmid Gene/Insert Promoter...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish... used in bacteria genome editing, though some mammalian systems have been developed. Figure 1: Overview...

  10. New England Biolabs Cell-Imaging Plasmid Collection

    Type
    Collection
    ...SNAP-tag Empty backbone for stable and transient mammalian expression 101133 pSNAP-CaaX Control Plasmid SNAP-tag...CLIP-tag Empty backbone for stable and transient mammalian expression 101134 pCLIPf-H2B Control Plasmid CLIP-tag...Vector ACP/MCP-tag Empty backbone for transient mammalian expression 101126 pACP-tag (m)- 2 Vector ACP/MCP-tag...MCP-tag Empty backbone for stable and transient mammalian expression 101132 pMCP-GPI Control Plasmid ACP...

  11. Validated gRNA Sequences

    Type
    Collection
    ... Kim BRI1 A. thaliana TTTGAAAGATGGAAGCGCGG cut S. pyogenes 26479191 Kim BRI1 A. thaliana TGAAACTAAACTGGTCCACA... pyogenes 23792628 Joung ETC2, TRY, and CPC A. thaliana 71288 cut S. pyogenes 26193878 Chen FANCF H. sapiens... 49772 cut S. pyogenes 24112467 Kamoun PDS3 A. thaliana GGACTTTTGCCAGCCATGGT 52255 cut S. pyogenes 23929339...CAAAAGACTGTCAATTCCCT cut S. pyogenes 26479191 Kim PHYB A. thaliana CACTAGGAGCAACACCCAA cut S. pyogenes 26479191 Kim...

  12. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ... al. described CRISPR-based genome editing in mammalian cell culture. Five years later, PubMed lists more...permanent genome edits or double-strand breaks. In mammalian cells, Cas13-ADAR2 does not require a specific... this non-specific cleavage does not occur in mammalian cells. Purify : Epitope-tagged dCas9 can also ...has CRISPR plasmids for the following models: Mammalian systems (Human, mouse, and rat) Bacteria ( E. ...

  13. Zhang Lab CRISPR Page

    Type
    Collection
    ...nuclease system to facilitate genome editing in mammalian cells (Cong et al ., Science 2013, Ran et al ....Plasmids The CRISPR/Cas system can be implemented in mammalian cells by co-expressing the S. pyogenes Cas9 (SpCas9... are two sets of 3 vectors each available for mammalian endogenous gene activation using SAM: Addgene ...In vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9. Swiech L, Heidenreich...

  14. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... 19 William Hahn 23851 pDONR223-TBK1 TBK1 ALS William Hahn 23875 pDONR223-ERBB4 ERBB4 ALS William Hahn... and/or parkinsonism William Hahn 23452 pDONR223-PRKR EIF2AK2 VWM disease William Hahn 23504 pDONR223-...PINK1 PINK1 Parkinson's William Hahn 23520 pDONR223-LRRK2 LRRK2 Parkinson's William Hahn 23583 pDONR223-PANK2...Hallervorden-Spatz disease William Hahn 23620 pDONR223-FXN FXN Friedreich ataxia William Hahn 23640 pDONR223-...other Flag GST His TEV Other, non-FP Plasmid Type Mammalian, non-viral Lentiviral AAV Retroviral Bacterial...CSF1R CSF1R Hereditary diffuse leukoencephalopathy William Hahn 23955 YFP-Parkin PRKN YFP CMV Parkinson's ...Nolan 138134 pT7NT*-Bri2 113-231 R221E ITM2B NT T7 Familial British dementia Jan Johansson 138347 lentiCRISPR...

  15. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ... 40,964 Ingolia lab S cerevisiae CRISPRi v1 – barcodes 181005 161769 Inhibition Yeast Ingolia NA ~6 44,580...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish...D) Knockout Human Doench and Root 2nd 2 40,710 Inzolia Human CRISPR/Cas12a Multiplex Knockout 209551 209552...

  16. CRISPR Plasmids - dCas9-FokI

    Type
    Collection
    ... available for expression in mammalian systems and Drosophila. Mammalian ID Plasmid Gene/Insert Promoter...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish...

  17. Allen Institute for Brain Science AAV Enhancer Collection

    Type
    Collection
    ...pAAV-AiE2128m-minBG-SYFP2-WPRE3-BGHpA AiP1357 AiE2128m SYFP2 Endothelial cells Whole Brain 214497 pAAV-AiE2135m-minBG-...pAAV-AiE2135m-minBG-SYFP2-WPRE3-BGHpA AiP1427 AiE2135m SYFP2 Endothelial cells Whole Brain 229925 pAAV-AiE2135m-minBG-iCre...pAAV-AiE2135m-minBG-iCre(R297T)-BGHpA AiP14703 AiE2135m Cre Endothelial cells Whole Brain 208146 pAAV-AiE0395h-minBglobin-... R, Larsen R, Lee C, Lee AY, Leibly M, Lenz GH, Liang E, Lusk N, Malone J, Mollenkopf T, Morin E, Newman...

  18. CRISPR Plasmids - Epigenetics

    Type
    Collection
    ... for epigenetic modification in mammalian or plant systems. Mammalian ID Plasmid Gene/Insert Promoter ...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish...

  19. CRISPR Plasmids - Repress Gene Expression

    Type
    Collection
    ...available for expression in mammalian systems, bacteria, plants, and yeast. Mammalian ID Plasmid Gene/Insert...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish...

  20. CRISPR Plasmids - RNA Editing

    Type
    Collection
    ...for CRISPR plasmids for RNA editing in mammalian systems. Mammalian ID Plasmid Gene/Insert PI Publication...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish...
Showing: 21 - 40 of 96 results