...induce defined deletions between the two cleavage sites, while the addition of an ssODN donor template can...pU6-BbsI-chiRNA plasmid via the BbsI restriction sites. Design oligos based on the following template: ...known as pHD-DsRed-att). 51026 U6-BbsI-crRNA : Generates crRNA for use in combination with tracrRNA. 51434...

...plasmid, are recombined into a DNA molecule that incorporates sequences from both plasmids. This DNA molecule...for the AdenoBuilder genome assembly system; consolidates the regions present in pAd5-B6 ∆E3-GFP and pAd5... Vogelstein 16407 pAdEasy 2-GFP beta-gal Shuttle Test plasmid that contains β-gal and GFP; contains ∼10Kb...

...such as titering, purity assessment, sterility testing, and viral genome sequencing.... process: Titering Purity assessment Sterility testing Viral genome sequencing (VGS) Find detailed pricing...Addgene does not perform functional or in vivo testing. We recommend that you consult the original paper...

...transfer vectors you can find reporter plasmids to test whether or not you've efficiently generated infectious...recombinases to remove genes flanked by either loxP or frt sites respectively, and empty vectors to express your ...screening and forms blue colonies on LB/Amp/Xgal/IPTG plates — if your insert is successfully cloned into this...

... expressing dCas9-2xAM and gRNA cloned in Bbs I sites. 92221 pLenti_dCas9-2xAM_hIRF-1 Lentiviral plasmid...genome functions.Fujita T, Yuno M, Fujii H. BMC Res Notes. 2018 Jun 14;11(1):387. doi: 10.1186/s13104-018-...epitope tags. Fujita T, Yuno M, Fujii H. BMC Res Notes. 2018 Feb 27;11(1):154. doi: 10.1186/s13104-018-...

...both the N and C terminus and induces mutation at rates much higher than the parental vectors. pC-GoldyTALEN... Features include (i) Esp3I (BsmBI) restriction sites for full compatibility with the Golden Gate TALEN... 21179091), as well as (v) distinct selection cassettes on pTAL7a and pTAL7b for enrichment of double-...

... 42242 cut S. pyogenes 23360964 Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut S. pyogenes 25336740...pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740...GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186 Liu near LoxP sites synthetic CGAAGTTATATTAAGGGTTC 69992 cut S. pyogenes...

...changes, researchers use ssDNA or dsDNA repair templates with 1. homology to the DNA flanking the DSB and...Insert Promoter Selectable Marker PI Publication Parasites ID Plasmid Gene/Insert Promoter Selectable Marker...

...accessible toolset for scientists worldwide. Figure courtesy of IPI Browse Glypican Antibodies ID Recombinant...blocking ligand binding and receptor function Figure courtesy of IPI Browse Integrin Antibodies ID Recombinant...

...oxidizes its substrate (luciferin), it generates light that activates the opsin to either excite or inhibit...

...CRISPR family. After nicking the target DNA, Cas3 initiates single-strand DNA degradation. This degradation...targeted strand non-specifically along the way. Cas3 initiates a final double-strand break, either due to a boundary...

...Brzezinski Lab CRISPR Collection The Brzezinski lab investigates gene regulation in the context of the developing...fusion shuttle plasmid for shuttling U6-guide cassettes to make dual guide expressing plasmids dCas9-KRAB-MeCP2...

...contains pre-assembled genetic circuits such as logic gates and higher level gene networks. Sensing and Signaling...Quorum Sensing Ellis Lab GeneGuard Endy Lab Logic Gates , BIOFAB Promoter/BCD Kit , and pOSIP Plasmid Kit...

...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ... transcription factor and other protein binding sites. ID Plasmid Gene/Insert Promoter Selectable Marker...

... length of the spacer sequence between the half-sites (see Nuclease Expression Vectors for more details...two-hybrid reporter system but have NOT yet been tested for activity as ZFNs in zebrafish. Target Gene ...

...microbial fields, including bacteria, viruses, parasites such as protozoa, and fungi. Find plasmids below...microbiology resources. The plasmids Addgene distributes cannot be used to reconstitute self-replicating...

...set of plasmids for building homologous repair templates that incorporate a self-excising drug selection...Center (CGC) - The CGC collects, maintains, and distributes stocks of C. elegans. Silencing Genomes - Cold...

...interference demonstrates a role for Nramp1 in modifying susceptibility to type 1 diabetes. Kissler S, ...

...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ... transcription factor and other protein binding sites. ID Plasmid Gene/Insert Promoter PI Publication ...

... procedures. Additionally, because this virus integrates randomly into the host genome, it has the potential...interest, also can express shRNA (cloning H1-shRNA cassettes into the unique SnaBI site in the 3´-LTR). See...