Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 41 - 60 of 105 results
  1. All Antibodies

    Type
    Collection
    ... All Antibodies All Antibodies Addgene distributes ready-to-use recombinant antibodies. These monoclonal...recommended applications based on our in-house testing and data provided by trusted outside labs – with... represent the official views of the National Institutes of Health. Need Some Help? Browse some of our...
  2. FlyCRISPR

    Type
    Collection
    ...induce defined deletions between the two cleavage sites, while the addition of an ssODN donor template can...pU6-BbsI-chiRNA plasmid via the BbsI restriction sites. Design oligos based on the following template: ...known as pHD-DsRed-att). 51026 U6-BbsI-crRNA : Generates crRNA for use in combination with tracrRNA. 51434...
  3. Adenovirus Plasmids

    Type
    Collection
    ...plasmid, are recombined into a DNA molecule that incorporates sequences from both plasmids. This DNA molecule...for the AdenoBuilder genome assembly system; consolidates the regions present in pAd5-B6 ∆E3-GFP and pAd5... Vogelstein 16407 pAdEasy 2-GFP beta-gal Shuttle Test plasmid that contains β-gal and GFP; contains ∼10Kb...
  4. TALENs for the EGFP Reporter Gene

    Type
    Collection
    ...Pre-constructed pairs of TALEN plasmids targeting 48 sites in the EGFP reporter gene....large series of engineered TALENs targeted to 48 sites in the EGFP reporter gene ( Reyon & Tsai et al.,...TALENs that were shown to be active at their target sites on an integrated EGFP reporter gene in cultured ...
  5. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...transfer vectors you can find reporter plasmids to test whether or not you’ve efficiently generated infectious...recombinases to remove genes flanked by either loxP or frt sites respectively, and empty vectors to express your ...screening and forms blue colonies on LB/Amp/Xgal/IPTG plates – if your insert is successfully cloned into this...
  6. Fujii Lab CRISPR Plasmids

    Type
    Collection
    ... expressing dCas9-2xAM and gRNA cloned in Bbs I sites. 92221 pLenti_dCas9-2xAM_hIRF-1 Lentiviral plasmid...genome functions.Fujita T, Yuno M, Fujii H. BMC Res Notes. 2018 Jun 14;11(1):387. doi: 10.1186/s13104-018-...epitope tags. Fujita T, Yuno M, Fujii H. BMC Res Notes. 2018 Feb 27;11(1):154. doi: 10.1186/s13104-018-...
  7. TALEN Plasmids and Kits

    Type
    Collection
    ...both the N and C terminus and induces mutation at rates much higher than the parental vectors. pC-GoldyTALEN... Features include (i) Esp3I (BsmBI) restriction sites for full compatibility with the Golden Gate TALEN... 21179091), as well as (v) distinct selection cassettes on pTAL7a and pTAL7b for enrichment of double-...
  8. CRISPR-Cas/RGN expression plasmids for Zebrafish

    Type
    Collection
    ...vectors to efficiently modify nine different target sites in endogenous zebrafish genes (Hwang & Fu et al....targeted to a sequence of interest. Potential target sites can be identified using the publicly available, ...
  9. Validated gRNA Sequences

    Type
    Collection
    ... 42242 cut S. pyogenes 23360964 Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut S. pyogenes 25336740...pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740...GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186 Liu near LoxP sites synthetic CGAAGTTATATTAAGGGTTC 69992 cut S. pyogenes...
  10. CRISPR Plasmids - Double-Strand Break (Cut)

    Type
    Collection
    ...changes, researchers use ssDNA or dsDNA repair templates with 1. homology to the DNA flanking the DSB and...Insert Promoter Selectable Marker PI Publication Parasites Plasmid Gene/Insert Promoter Selectable Marker...
  11. Brzezinski Lab CRISPR Collection

    Type
    Collection
    ...Brzezinski Lab CRISPR Collection The Brzezinski lab investigates gene regulation in the context of the developing...fusion shuttle plasmid for shuttling U6-guide cassettes to make dual guide expressing plasmids dCas9-KRAB-MeCP2...
  12. TALENs for Endogenous Human Genes

    Type
    Collection
    ...target sites in cultured U2OS cells. Target Gene Name TALENs Full Target Site (5' to 3'; half-sites in CAPS...
  13. Synthetic Biology - Overview

    Type
    Collection
    ...contains pre-assembled genetic circuits such as logic gates and higher level gene networks. Sensing and Signaling...Quorum Sensing Ellis Lab GeneGuard Endy Lab Logic Gates , BIOFAB Promoter/BCD Kit , and pOSIP Plasmid Kit...
  14. CRISPR Plasmids - Yeast

    Type
    Collection
    ...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ... transcription factor and other protein binding sites. Plasmid Gene/Insert Promoter Selectable Marker ...
  15. Zinc Finger Consortium: Zinc Finger Arrays

    Type
    Collection
    ... length of the spacer sequence between the half-sites (see Nuclease Expression Vectors for more details...two-hybrid reporter system but have NOT yet been tested for activity as ZFNs in zebrafish. Target Gene ...
  16. Microbiology Resources

    Type
    Collection
    ...microbial fields, including bacteria, viruses, parasites such as protozoa, and fungi. Find plasmids below...microbiology resources. The plasmids Addgene distributes cannot be used to reconstitute self-replicating...
  17. Worm Expression Resources

    Type
    Collection
    ...set of plasmids for building homologous repair templates that incorporate a self-excising drug selection...Center (CGC) - The CGC collects, maintains, and distributes stocks of C. elegans. Silencing Genomes - Cold...
  18. Mammalian RNAi Tools

    Type
    Collection
    ...interference demonstrates a role for Nramp1 in modifying susceptibility to type 1 diabetes. Kissler S, ...
  19. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ... transcription factor and other protein binding sites. Plasmid Gene/Insert Promoter PI Publication 3xFLAG-dCas9...
Showing: 41 - 60 of 105 results