Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 149 results for: ins

Showing: 81 - 100 of 149 results

  1. AAV Viral Preps

    Type
    Collection
    ...DREADDs, PSAMs Optogenetics Channelrhodopsins, Halorhodopsins, Archaerhodopsins Recombinases Cre, Flp, Dre...Sensors, Voltage Reporters Controls Fluorescent Proteins, Spagehetti Monster, Brainbow Molecular Tools ...

  2. CRISPR Plasmids - Parasites

    Type
    Collection
    ...joining (NHEJ), a mechanism which frequently causes insertions or deletions (indels) in the DNA. Indels often...repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental systems, HDR occurs...much lower efficiency than NHEJ. ID Plasmid Gene/Insert Selectable Marker PI Publication Libraries Toxoplasma...knockout gRNA pooled library designed with 10 guides against 8,158 predicted protein-coding genes. Do you have...

  3. CRISPR Plasmids - C. elegans

    Type
    Collection
    ...joining (NHEJ), a mechanism which frequently causes insertions or deletions (indels) in the DNA. Indels often...repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental systems, HDR occurs...much lower efficiency than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically ...activator to your specific locus. ID Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors...

  4. Plasmids for Stem Cell Research

    Type
    Collection
    ... L-Myc, Lin28, OCT3/4, and shRNA against p53 in different gene/insert combinations A more efficient method...regenerative medicine. iPSCs, much like their ES cell cousins, have the hallmarks of pluripotent cells--they ...Ottosson Stem Cell Research Plasmids This table contains a general list of plasmids that have been used...name, species, gene name, and more. Plasmid Gene/Insert Vector Type PI Publication Do you have suggestions...

  5. TALEN Guide

    Type
    Collection
    ...for targeting enzymes and other useful protein domains to a specific DNA sequence ( Figure 1A ). Scientists...consisting of 12-31 repeats can be assembled and inserted into a variety of backbones in just a few steps...Toolbox", from Dr. Feng Zhang’s group at the Broad Institute, will be available from Addgene before the end...Pubmed PMID: 21822241 . TAL effectors: customizable proteins for DNA targeting Bogdanove AJ, Voytas DF. Science...

  6. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...ml). NOTE: Phosphorylated oligos may be ordered instead. For this approach, the use of T4 PNK is omitted...type. While MEL cells are suspension cells, instructions for adherent cells have also been included. ... clones to a single 96-well plate that already contains 50 μl cell culture media per well for a final ...protein, perform an immunoblot using an antibody against the relevant protein 9 . References This protocol...

  7. Neuroscience

    Type
    Collection
    ...recombinant antibodies targeting neuroscience-related proteins....currently available from our catalog that target proteins popular in neuroscience research. These ready-... represent the official views of the National Institutes of Health....

  8. CRISPR Plasmids - dCas9-FokI

    Type
    Collection
    ...Mammalian ID Plasmid Gene/Insert Promoter PI Publication Drosophila ID Plasmid Gene/Insert Promoter PI Publication...Publication Yeast ID Plasmid Gene/Insert Promoter PI Publication Do you have suggestions for other plasmids...

  9. Michael Davidson Fluorescent Protein Collection

    Type
    Collection
    ... Plasmid Collections Fluorescent Proteins Michael Davidson Fluorescent Protein Collection...collection of ORFs tagged with a variety of fluorescent proteins. The majority of the ORFs are of mammalian origin...different fluorescent tags for you to create fusion proteins with your gene of interest. Please visit Michael...

  10. CRISPR Plasmids - RNA Targeting

    Type
    Collection
    ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Bacterial ID Plasmid Gene/Insert PI Publication...Publication Plant ID Plasmid Gene/Insert PI Publication Do you have suggestions for other plasmids that should...

  11. CRISPR Plasmids - Xenopus

    Type
    Collection
    ...joining (NHEJ); a mechanism which frequently causes insertions or deletions (InDels) in the DNA, possibly resulting... with the Cas9 and gRNA plasmids, the cell may instead repair the break using homology-directed repair...introduce specific genomic changes. ID Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors...

  12. CRISPR Plasmids - Zebrafish

    Type
    Collection
    ...joining (NHEJ), a mechanism which frequently causes insertions or deletions (indels) in the DNA. Indels often...repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental systems, HDR occurs...much lower efficiency than NHEJ. ID Plasmid Gene/Insert Vector Type Promoter PI Publication Empty gRNA ...

  13. Structural Genomics Consortium Plasmids

    Type
    Collection
    ... determine the three dimensional structures of proteins of medical relevance, and place them in the public...pFHMSP-LIC-N N/A Expression vector for secreted proteins with N-terminal hexahistidine tag and TEV cleavage...pFHMSP-LIC-C N/A Expression vector for secreted proteins with C-terminal hexahistidine tag and TEV cleavage...

  14. CRISPR Plasmids - gRNAs

    Type
    Collection
    ...recommended that you determine if your cell type contains the target sequence before using any of these ...single species or PAM binding variant of Cas9. For instance, wild-type SpCas9 must be used with targets that...experimental use of these plasmids. ID Plasmid Gene/Insert Vector Type PI Publication Do you have suggestions...

  15. CRISPR Plasmids and Resources

    Type
    Collection
    ...generates large genomic deletions. Insert NEW CRISPR transposases insert large fragments of DNA. Transcriptional...nickase enzymes fused to reverse transcriptase install new genetic information into a specific DNA site...

  16. p53 Pathway

    Type
    Collection
    ...candidate Scotin Shisa family member 5 Sestrins SESN1 SESN2 SESN3 Sestrins 1, 2, or 3 Siah Siah E3 ubiquitin...DNA-damage-inducible; alpha, beta, or gamma IGF-BP3 Insulin-like growth factor binding protein 3 KAI CD82 molecule...

  17. Validated gRNA Sequences

    Type
    Collection
    ...GTGGTGGGCCGCAGTCACAA 66894 cut S. pyogenes 26178787 Winslow Lox-STOP-Lox synthetic GCGTATAGCATACATTATACG 66586...GCGAGGTATTCGGCTCCGCG 66895 cut S. pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT...TCATGGCTGATGCAATGCGG 67594 cut S. pyogenes 26178787 Winslow NeuN M. musculus TCCGGTTCAGGGACCCCGAC 60227 cut... cut S. pyogenes 26480473 Wolfe ttTi5605 Mos1 insertion site C. elegans ATATCAGTCTGTTTCGTAA 47550 cut ...

  18. Brain Initiative Collection

    Type
    Collection
    ...that expresses tTA from the hSyn1 promoter that contains a positive feedback loop for amplifed expression...expression of the tTA from the hSyn1 promoter. Contains a positive feedback loop for amplifed expression...-AAV9 pAAV-hsyn-GRAB_DA-mut Expresses the DA-insensitive control sensor GRAB_DA-mut in neurons Yulong ...pAAV-hsyn-GRAB_rDA-mut Expresses the red fluorescent DA-insensitive control sensor GRAB_rDA-mut in neurons Yulong...

  19. Tags and Other Markers

    Type
    Collection
    ...antibodies targeting epitope tags and common fusion proteins.... target epitope tags and other common cellular proteins. These ready-to-use recombinant monoclonal antibodies...

  20. Synthetic Biology - Sensing and Signaling

    Type
    Collection
    ...Networks & Gene Regulation Sensing & Signaling Strains Browse Addgene's collection of synthetic biology...available from this depositor's lab. Plasmid Gene/Insert Vector Type Promoter Tags PI Publication Do you...
Showing: 81 - 100 of 149 results