We narrowed to 149 results for: ins;
-
TypeCollection...for targeting enzymes and other useful protein domains to a specific DNA sequence ( Figure 1A ). Scientists...consisting of 12-31 repeats can be assembled and inserted into a variety of backbones in just a few steps...Toolbox", from Dr. Feng Zhang’s group at the Broad Institute, will be available from Addgene before the end...Pubmed PMID: 21822241 . TAL effectors: customizable proteins for DNA targeting Bogdanove AJ, Voytas DF. Science...
-
Cre-Lox and Other Site-Specific Recombinases
TypeCollection...drug-inducible approach may also be used. Split proteins: The recombinase is split into inactive N- and... repetitive recombination leading to genomic instability and cell death. It is important to incorporate...Recombinase Plasmids ID Plasmid Description Gene/Insert Vector Type Promoter PI Return to top Recombinase-Dependent...making transgenic mice. ID Plasmid Description Gene/Insert Vector Type PI Pooled Libraries Pooled Library ... -
Genomic Deletions in Mammalian Cell Lines
TypeCollection...ml). NOTE: Phosphorylated oligos may be ordered instead. For this approach, the use of T4 PNK is omitted...type. While MEL cells are suspension cells, instructions for adherent cells have also been included. ... clones to a single 96-well plate that already contains 50 μl cell culture media per well for a final ...protein, perform an immunoblot using an antibody against the relevant protein 9 . References This protocol... -
Neuroscience
TypeCollection...recombinant antibodies targeting neuroscience-related proteins....currently available from our catalog that target proteins popular in neuroscience research. These ready-... represent the official views of the National Institutes of Health.... -
CRISPR Plasmids - dCas9-FokI
TypeCollection...Mammalian ID Plasmid Gene/Insert Promoter PI Publication Drosophila ID Plasmid Gene/Insert Promoter PI Publication...Publication Yeast ID Plasmid Gene/Insert Promoter PI Publication Do you have suggestions for other plasmids... -
Michael Davidson Fluorescent Protein Collection
TypeCollection... Plasmid Collections Fluorescent Proteins Michael Davidson Fluorescent Protein Collection...collection of ORFs tagged with a variety of fluorescent proteins. The majority of the ORFs are of mammalian origin...different fluorescent tags for you to create fusion proteins with your gene of interest. Please visit Michael... -
CRISPR Plasmids - RNA Targeting
TypeCollection...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Bacterial ID Plasmid Gene/Insert PI Publication...Publication Plant ID Plasmid Gene/Insert PI Publication Do you have suggestions for other plasmids that should... -
CRISPR Plasmids - Xenopus
TypeCollection...joining (NHEJ); a mechanism which frequently causes insertions or deletions (InDels) in the DNA, possibly resulting... with the Cas9 and gRNA plasmids, the cell may instead repair the break using homology-directed repair...introduce specific genomic changes. ID Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors... -
CRISPR Plasmids - Zebrafish
TypeCollection...joining (NHEJ), a mechanism which frequently causes insertions or deletions (indels) in the DNA. Indels often...repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental systems, HDR occurs...much lower efficiency than NHEJ. ID Plasmid Gene/Insert Vector Type Promoter PI Publication Empty gRNA ... -
Structural Genomics Consortium Plasmids
TypeCollection... determine the three dimensional structures of proteins of medical relevance, and place them in the public...pFHMSP-LIC-N N/A Expression vector for secreted proteins with N-terminal hexahistidine tag and TEV cleavage...pFHMSP-LIC-C N/A Expression vector for secreted proteins with C-terminal hexahistidine tag and TEV cleavage... -
CRISPR Plasmids - gRNAs
TypeCollection...recommended that you determine if your cell type contains the target sequence before using any of these ...single species or PAM binding variant of Cas9. For instance, wild-type SpCas9 must be used with targets that...experimental use of these plasmids. ID Plasmid Gene/Insert Vector Type PI Publication Do you have suggestions... -
CRISPR Plasmids and Resources
TypeCollection...generates large genomic deletions. Insert NEW CRISPR transposases insert large fragments of DNA. Transcriptional...nickase enzymes fused to reverse transcriptase install new genetic information into a specific DNA site... -
Validated gRNA Sequences
TypeCollection...GTGGTGGGCCGCAGTCACAA 66894 cut S. pyogenes 26178787 Winslow Lox-STOP-Lox synthetic GCGTATAGCATACATTATACG 66586...GCGAGGTATTCGGCTCCGCG 66895 cut S. pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT...TCATGGCTGATGCAATGCGG 67594 cut S. pyogenes 26178787 Winslow NeuN M. musculus TCCGGTTCAGGGACCCCGAC 60227 cut... cut S. pyogenes 26480473 Wolfe ttTi5605 Mos1 insertion site C. elegans ATATCAGTCTGTTTCGTAA 47550 cut ... -
p53 Pathway
TypeCollection...candidate Scotin Shisa family member 5 Sestrins SESN1 SESN2 SESN3 Sestrins 1, 2, or 3 Siah Siah E3 ubiquitin...DNA-damage-inducible; alpha, beta, or gamma IGF-BP3 Insulin-like growth factor binding protein 3 KAI CD82 molecule... -
Kazuhiro Oka Lentiviral Vectors
TypeCollection...Addgene #73356) . pICPIS-EF1 contains the EF1 promoter while pICPIS-CB contains the Chicken-beta actin promoter...promoter pLL3.7-TNFa-shRNA3 72598 Expresses shRNA against mouse TNF-alpha mRNA from the mouse U6 promoter... -
Brain Initiative Collection
TypeCollection...that expresses tTA from the hSyn1 promoter that contains a positive feedback loop for amplifed expression...expression of the tTA from the hSyn1 promoter. Contains a positive feedback loop for amplifed expression...-AAV9 pAAV-hsyn-GRAB_DA-mut Expresses the DA-insensitive control sensor GRAB_DA-mut in neurons Yulong ...pAAV-hsyn-GRAB_rDA-mut Expresses the red fluorescent DA-insensitive control sensor GRAB_rDA-mut in neurons Yulong... -
Tags and Other Markers
TypeCollection...antibodies targeting epitope tags and common fusion proteins.... target epitope tags and other common cellular proteins. These ready-to-use recombinant monoclonal antibodies... -
Synthetic Biology - Sensing and Signaling
TypeCollection...Networks & Gene Regulation Sensing & Signaling Strains Browse Addgene's collection of synthetic biology...available from this depositor's lab. Plasmid Gene/Insert Vector Type Promoter Tags PI Publication Do you... -
TREAT-AD Plasmid Collection
TypeCollection...table based on plasmid name, gene/insert, and more. ID Plasmid Gene/Insert Vector Type Backbone Mutations... -
Synthetic Biology - Metabolism
TypeCollection...Networks & Gene Regulation Sensing & Signaling Strains Browse Addgene's collection of synthetic biology...available from this depositor's lab. Plasmid Gene/Insert Vector Type Promoter PI Publication Back to Top...