...mycoplasma contamination using mycoplasma detection kits. The cell line is maintained for ~20 passages before...prepared using endotoxin-free plasmid purification kits. Resources Browse lentiviral preps available from...

... order, Login or Register a new account. Add the kit or individual plasmids to your cart, then complete...

...select CRISPR lentiviral plasmids. CRISPR Plasmid Kits : Find groups of plasmids that are used together...

... Addgene's Protocol for RNA Extraction Without A Kit External Resources For more research related resources...

...variety of worm gene promoters C. elegans vector kit - Collection of plasmids from Dr. ...expression in E. coli TALENs Gene targeting TALEN kits - Construct a custom TALEN array ...

...into a single mammalian expression vector A tool kit for rapid cloning and expression of recombinant antibodies...

...usually more concentrated than using other kits like the Qiagen kit, so its better for PCR and surveyor. I...

...and clone the amplicons ( e.g., with a PCR cloning kit) into a plasmid vector. Transform the plasmid into...from bacterial colonies using the Qiagen Miniprep Kit. Zhang S, Cahalan MD. J. Vis. Exp . 2007...

...26480473 Wolfe Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT 60969 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus...CTAACGTTCCAGCGCTCGTT 60970 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus GTCAAGATGTCATCTTACGG 60971 cut S....

...p53 Pathway You May Also Like: Cancer Pathway ORF Kit mTOR pathway Ras pathway Background p53 Pathway Plasmids...

...fluorescence at a target region, as in the CRISPRainbow kit. Plasmid Gene/Insert Promoter Selectable Marker PI...

...biosensors can also be constructed using the cpFRET kit from the Pertz laboratory. Empty Vectors Encoding...

... the cpFRET kit from the Pertz laboratory to construct custom biosensors. The ScEnSor Kit from the Olsson...neuropeptides VIP, NPY, CCK, NTS, UCN, SST, and CRF A tool kit of highly selective and sensitive genetically encoded...intracellular environment of S. cerevisiae . The MOSAIC Kit from the Cohen laboratory includes 19 lentiviral ... Angew Chem Int Ed Engl. 2018 Jun 27. Tetsuya Kitaguchi ATP Variants of ATP sensor iATPSnFR1.0 and iATPSnFR1.1.... PLoS One. 2014 Jun 24;9(6):e100252. Tetsuya Kitaguchi cAMP (cyclic AMP) Red fluorescent protein-based...imaging. Sci Rep. 2017 Aug 4;7(1):7351. Tetsuya Kitaguchi cAMP (cyclic AMP) Fluorescent sensor of cyclic...PDE5alpha. ACS Sens. 2017 Jan 27;2(1):46-51. Tetsuya Kitaguchi cGMP (cyclic GMP) FlincG3 (GFP-based cGMP sensor...

...repair template for an individual tagging event. The kit contains 26 plasmids; 21 of the plasmids are for ...Jorgensen Lab SapTrap CRISPR/Cas Toolkit SapTrap is a modular toolkit from Erik Jorgensen's lab for building...targeting vector. Jorgensen Lab SapTrap CRISPR/Cas Toolkit Kanemaki Lab Auxin-Inducible Degron Tagging Masato...

...for 2014 Phosphoprotein Reagents 691.3 KB Original Kit (ca. 2011) Described in: Expanding the genetic code...

...plasmids: pVSVg , psPAX2 positive control: CMV-EGFP Kits are also available (mouse or human libraries) PDF...opens in a new window) . GenET (Genome Editing Toolkit) (Link opens in a new window) is a library of various...

... Addgene's Protocol for RNA Extraction Without A Kit More Coronavirus Resources For more research related...available from Stanley Qi's lab. COVID-19 Diagnostic Toolkit Enzymes. (unpublished) Taq polymerase and MMLV ...

... Additional Resources Plasmid Kits and Collections Human Kinase ORF Kit : 558 distinct human kinases and...growth factor-like protein 2 - KITLG KIT ligand DKFZp686F2250, KL-1, Kitl, MGF, SCF, SF, SHEP7 KL klotho...Root . Multiple Lentiviral Expression (MuLE) System Kit : A modular and flexible system that can be used ...infection from the lab of Ian Frew . MXS Chaining Kit : From the lab of Pierre Neveu , the MXS-chaining...applications in mammalian systems. The MXS-chaining kit includes chaining vectors with multiple cloning sites... inducible gene expression. Myristoylated Kinase Kit : Consists of 190 human kinases and kinase-related... Hahn , Matthew Meyerson , and David Root , this kit consists of 182 wild-type and 19 well-characterized...

... the membrane. Activate the HRP with a substrate kit. Image the membrane using either X-ray film in a ...

...Description PI Multiplex CRISPR/Cas9 Assembly System Kit Mammalian A system for constructing all-in-one expression... Cas9 from CBh promoter. Ventura A CRISPR/Cas9 toolkit for multiplex genome editing in plants Plant Plasmids...