...IGKJ1 immunoglobulin kappa joining 1 J1 IGKJ2 immunoglobulin kappa joining 2 J2 IGKJ3 immunoglobulin kappa...IGKJ4 immunoglobulin kappa joining 4 J4 IGKJ5 immunoglobulin kappa joining 5 J5 IGKV@ immunoglobulin kappa...CD79a molecule, immunoglobulin-associated alpha IGA, MB-1 CD79B CD79b molecule, immunoglobulin-associated ...MGC102857 IGHA2 immunoglobulin heavy constant alpha 2 (A2m marker) - IGHD immunoglobulin heavy constant...MGC29633 IGHD@ immunoglobulin heavy diversity group IGD1, IGHDY1 IGHD1-1 immunoglobulin heavy diversity...IGHD1-14 immunoglobulin heavy diversity 1-14 (non-functional) DM2, IGHD114 IGHD1-20 immunoglobulin heavy ... IGHD120 IGHD1-26 immunoglobulin heavy diversity 1-26 IGHD126 IGHD1-7 immunoglobulin heavy diversity 1...

... ubiquitous genome engineering in Drosophila melanogaster. Bullock 62208 pnos-Cas9-nos Expresses Cas9 ... restricted genome engineering in Drosophila melanogaster. Bullock 62211 pAct-Fok1:dCas9 Expresses Fok1...specificity genome engineering in Drosophila melanogaster. Bullock 62210 pnos-Fok1:dCas9-nos Expresses...specificity genome engineering in Drosophila melanogaster. Bullock...

...reprogramming human cells to pluripotency by activating enogenous genes Human pluripotent reprogramming with CRISPR...Otonkoski Lentivirus Human Expression of human Sox2, Nanog, Oct4, and Lin28 from four separate lentiviral plasmids...polycistronic expression of human Oct4, Klf4, Sox2, c-Myc, Nanog, Lin28, NR5A2, and microRNA 302/367 in three different... gene-specific plasmids at the following links: NANOG , OCT4 , SOX2 , MYC , KLF4 , LIN28 . Differentiation... reprogramming of fibroblasts to expandable, myelinogenic oligodendrocyte progenitor cells. Nat Biotechnol...

...25619936 Sato NANOG H. sapiens TGGCATATTCCTGATTTAAAAGT 64156 activate S. pyogenes 25619936 Sato NANOG H. sapiens...25619936 Sato NANOG H. sapiens TGGGCCTTGGTGAGACTGGTAGA 64154 activate S. pyogenes 25619936 Sato NANOG H. sapiens...61250 cut S. pyogenes 25491644 Ward yellow D. melanogaster GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186...

...gene delivery in-vivo because of their mild immunogencity. These viruses can direct long-term transgene...commonly used as vaccines because of the strong immunogenic response they induce. Some (oncolytic) adenoviruses...preferred for in-vivo studies because of its low immunogenicity. Different types of viruses also vary in the...

...contamination in vector preparations can alter the immunogenic properties of the final product, particularly...plasmid purification protocol. To minimize the immunogenic properties of the final vector preparation, the...

...Youle 59720 Nanog-CreER targeting construct Cre-ERT2; Targeting vector for Nanog locus mNanog Mammalian ...

...Neelamegham 3rd 10 3,637 Oxford Fly 64750 Knockout D. melanogaster Liu N/A 3 40,279 Pan-Druggable Cancer Library...

... metabolism, fibrosis, atherosclerosis, and carcinogenesis. The defining feature of the KLF family is ...

...CRISPR system to rapidly engineer the constant immunoglobulin domains to obtain recombinant hybridomas, which...

... Serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 PERP TP53...

...Protein Microarray Identifies the High Affinity Immunoglobulin E Receptor Subunit α (FcεR1α) as an Activating...

...neurological mouse models including complex and monogenic diseases. Alzforum is a news website and information...

...germline mutations in Bombyx mori and Drosophila melanogaster . Zhang Lab TALE Toolbox 49622 - 49647 24 plasmids...

... (CD147), transmembrane glycoprotein of the immunoglobulin superfamily, binds to the SARS-CoV-2 S protein...