...induce defined deletions between the two cleavage sites, while the addition of an ssODN donor template can...pU6-BbsI-chiRNA plasmid via the BbsI restriction sites. Design oligos based on the following template: ...known as pHD-DsRed-att). 51026 U6-BbsI-crRNA : Generates crRNA for use in combination with tracrRNA. 51434...

...plasmid, are recombined into a DNA molecule that incorporates sequences from both plasmids. This DNA molecule...for the AdenoBuilder genome assembly system; consolidates the regions present in pAd5-B6 ∆E3-GFP and pAd5... Vogelstein 16407 pAdEasy 2-GFP beta-gal Shuttle Test plasmid that contains β-gal and GFP; contains ∼10Kb...

...Pre-constructed pairs of TALEN plasmids targeting 48 sites in the EGFP reporter gene....large series of engineered TALENs targeted to 48 sites in the EGFP reporter gene ( Reyon & Tsai et al.,...TALENs that were shown to be active at their target sites on an integrated EGFP reporter gene in cultured ...

...ID Plasmid Description PI Viral Preps Addgene distributes ready-to-use viral preps made from plasmids in...and targeted to the neuronal soma and proximal dendrites in a viral vector Hillel Adesnik 108422-AAV5 pAAV-CAG-FLEX-Archon1...ChroME targeted to the neuronal soma and proximal dendrites and separated from nuclear mRuby3 by P2A in a ...(EF1a) Francois St-Pierre Antibodies Addgene distributes ready-to-use recombinant antibodies made from...

...transfer vectors you can find reporter plasmids to test whether or not you’ve efficiently generated infectious...recombinases to remove genes flanked by either loxP or frt sites respectively, and empty vectors to express your ...screening and forms blue colonies on LB/Amp/Xgal/IPTG plates – if your insert is successfully cloned into this...

... expressing dCas9-2xAM and gRNA cloned in Bbs I sites. 92221 pLenti_dCas9-2xAM_hIRF-1 Lentiviral plasmid...genome functions.Fujita T, Yuno M, Fujii H. BMC Res Notes. 2018 Jun 14;11(1):387. doi: 10.1186/s13104-018-...epitope tags. Fujita T, Yuno M, Fujii H. BMC Res Notes. 2018 Feb 27;11(1):154. doi: 10.1186/s13104-018-...

...both the N and C terminus and induces mutation at rates much higher than the parental vectors. pC-GoldyTALEN... Features include (i) Esp3I (BsmBI) restriction sites for full compatibility with the Golden Gate TALEN... 21179091), as well as (v) distinct selection cassettes on pTAL7a and pTAL7b for enrichment of double-...

...vectors to efficiently modify nine different target sites in endogenous zebrafish genes (Hwang & Fu et al....targeted to a sequence of interest. Potential target sites can be identified using the publicly available, ...

...TALE activator binding sites in any given sequence of interest. The program generates graphical guides that...

... 42242 cut S. pyogenes 23360964 Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut S. pyogenes 25336740...pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740...GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186 Liu near LoxP sites synthetic CGAAGTTATATTAAGGGTTC 69992 cut S. pyogenes...

...changes, researchers use ssDNA or dsDNA repair templates with 1. homology to the DNA flanking the DSB and...Insert Promoter Selectable Marker PI Publication Parasites Plasmid Gene/Insert Promoter Selectable Marker...

...Brzezinski Lab CRISPR Collection The Brzezinski lab investigates gene regulation in the context of the developing...fusion shuttle plasmid for shuttling U6-guide cassettes to make dual guide expressing plasmids dCas9-KRAB-MeCP2...

...target sites in cultured U2OS cells. Target Gene Name TALENs Full Target Site (5' to 3'; half-sites in CAPS...

...contains pre-assembled genetic circuits such as logic gates and higher level gene networks. Sensing and Signaling...Quorum Sensing Ellis Lab GeneGuard Endy Lab Logic Gates , BIOFAB Promoter/BCD Kit , and pOSIP Plasmid Kit...

...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ... transcription factor and other protein binding sites. Plasmid Gene/Insert Promoter Selectable Marker ...

... length of the spacer sequence between the half-sites (see Nuclease Expression Vectors for more details...two-hybrid reporter system but have NOT yet been tested for activity as ZFNs in zebrafish. Target Gene ...

...microbial fields, including bacteria, viruses, parasites such as protozoa, and fungi. Find plasmids below...microbiology resources. The plasmids Addgene distributes cannot be used to reconstitute self-replicating...

...set of plasmids for building homologous repair templates that incorporate a self-excising drug selection...Center (CGC) - The CGC collects, maintains, and distributes stocks of C. elegans. Silencing Genomes - Cold...

...interference demonstrates a role for Nramp1 in modifying susceptibility to type 1 diabetes. Kissler S, ...

...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ... transcription factor and other protein binding sites. Plasmid Gene/Insert Promoter PI Publication 3xFLAG-dCas9...