...CCCAGTCACGACGTTGTAAAACG (Invitrogen) In lacZ gene M13/pUC Reverse AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene...AAATGATAACCATCTCGC (Invitrogen) Polyhedrin promoter, forward primer Polyhedrin reverse GTCCAAGTTTCCCTG (Invitrogen) For...Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward ...Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse...reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC (Invitrogen) For Pichia vectors with AOX1 promoter, forward...promoter, forward primer AC5 ACACAAAGCCGCTCCATCAG (Invitrogen) Drosophila Actin 5C promoter, forward primer...primer Alpha-factor TACTATTGCCAGCATTGCTGC (Invitrogen) Alpha factor signal sequence, forward primer Amp-R ...

...unlike RASSLs, show insensitivity to endogenous ligands, have low constitutive activity, and their activating...control of neuronal activity. Table 1. Descriptions of DREADDs and their activity in neurons DREADD Receptor...plasmids in your lab for interrogation of neuronal activity. Science...receptors exhibited high levels of constitutive activity, making them less than ideal. DREADDs Designer...was shown to have a small amount of constitutive activity, and is not widely used. There is also a DREADD...Compound 21 and DCZ seem to have minimal off-target activity, and do not seem to have the same back-metabolism...PSAMs Unlike DREADDs, which manipulate neuronal activity indirectly through GPCR signaling, another class...

...SpCas9-NG - NG; increase in vitro activity SpG - NGN; increase nuclease activity SpRY - NRN/NYN, where R ...nuclease activity Cas9 enzymes will likely improve as more key residues for specificity and activity are discovered...select for gRNAs with high on-target activity and low off-target activity. Knockout libraries often target...engineered to increase specificity and nuclease activity available. Engineered Cas9s have also led to reduced...off-target effects Sniper-Cas9 - less off-target activity; compatible with truncated gRNAs to increase specificity...about Cas9 variants . Anti-CRISPR Prolonged Cas9 activity can increase the risk of off-target cutting or...(Anti-CRISPR) proteins can help control CRISPR activity. Acr proteins have evolved in phages and other...

... the following enhancements: Increased light sensitivity Example: ArchT Increased photocurrent amplitude...salinarum (strain Shark), used to silence neuronal activity 632 Halo/NpHR Light-driven inward chloride pump...Natronomonas pharaonis , used to silence neuronal activity 589 eNpHR 3.0 NpHR with addition of trafficking...from Halorubrum strain TP009. Improved light sensitivity over Arch. 566 eArchT 3.0 ArchT with addition...exquisite spatial and temporal control of protein activity. Phytochrome, cryptochrome, and LOV (light oxygen...described above, both LOV and Dronpa can control activity of a fused protein through allosteric interactions...Rhodopseudomonas palustris bacteria. Key feature is the sensitivity to 740- to 780-nm near-infrared light. 740–780...

...BL21 Invitrogen; New England BioLabs E. coli B F dcm ompT hsdS(rB mB) gal ccdB Survival Invitrogen F- mcrA...luciferase or GFP) that offers a read-out of the activity of the genetic element. For instance, a promoter... rpsL (StrR) endA1 nupG tonA::Ptrc ccdA DB3.1 Invitrogen F- gyrA462 endA Delta(sr1-recA) mcrB mrr hsdS20...proA2 rpsL20(StrR) xyl5 lambda- leu mtl1 DH5alpha Invitrogen F- Phi80lacZDeltaM15 Delta(lacZYA-argF) U169 ...rpsL (StrR) rph spoT1 ∆(mrr-hsdRMS-mcrBC) Stbl3 Invitrogen F– mcrB mrr hsdS20 (rB–, mB–) recA13 supE44 ara...proA2 rpsL20 (StrR ) xyl-5 λ– leu mtl-1 Top10 Invitrogen F- mcrA Delta(mrr-hsdRMS-mcrBC) Phi80lacZM15 ...a test tube to copy DNA regions of interest. In vitro DNA replication requires the 4 nucleotides, a DNA...

...viral delivery RNA delivery of Cas9 and gRNA In vitro transcription reactions generate mature Cas9 mRNA...ribonucleoprotein (RNP) complexes Purified Cas9 protein and in vitro transcribed gRNA are combined to form a Cas9-gRNA...expression of CRISPR components Short window of CRISPR activity may decrease off-target effects Additional Resources...gRNAs based on predicted on-target and off-target activity A PAM sequence is absolutely necessary for Cas9...high-fidelity Cas enzyme. In addition to off-target activity , it is also important to consider factors that...cleavage of the desired target sequence or on-target activity . Two gRNA targeting sequences with 100% homology...based on their predicted on-target and off-target activity ( see gRNA design software ). Additionally, many...

... Cloning (LIC) relies on the 3'-5' exonuclease activity of T4 DNA polymerase. An exonuclease is an enzyme...strand. In LIC, the T4 DNA polymerase’s exonuclease activity creates “chewed-back” overhangs of 10-12 base ...this opportunity, T4 will resume its polymerase activity, add back the free base, and become stuck at this...principle to Gibson cloning, but instead of an in vitro reaction with purified enzymes, it takes advantage...

...(~25 kD), but tend to have lower affinity and longevity. Single-domain antibodies - Single-domain antibodies...monoclonal antibodies tend to have less cross-reactivity and give lower background signals than polyclonal...interest is knocked down or out, and antibody reactivity is compared between the wild-type and the knockdown...cell line with low or no expression; antibody reactivity is then compared between the knock-in cell line...

...envelope protein Env (usually VSV‐G due to its wide infectivity) is encoded on a third, separate, envelope plasmid...homologous recombination of unstable regions, such as Invitrogen Stbl3™ or NEB Stable cells. This will ensure ...with which the attP sequences recombine. Visit Invitrogen's website for more information on the Gateway®...

.... Envelope gene (may be pseudotyped to alter infectivity): The use of the VSV-G envelope provides the ...tropism envelope protein; Pseudotyped to alter infectivity. Packaging Gag in trans Precursor structural ...

...efficiency in vitro than any wild type serotype; in vivo , it displays very high infectivity across a broad...

...molecules, which allows for specific control of activity. Read More CRISPR Class 2 C lustered R egularly...

...transcription of a gene is initiated. Promoters are a vital component of expression vectors because they control...