Skip to main content

We narrowed to 18 results for: lic

Showing: 1 - 18 of 18 results
  1. Molecular Cloning Techniques

    Type
    Guide
    ...Independent Cloning (LIC) relies on the 3' to 5' exonuclease activity of T4 DNA polymerase. In LIC, the T4 DNA ...where the normal replication process will repair the nicks. It is important to note that LIC has difficulty... structures. Read more in our SLIC blog post . Figure 6: Summary of LIC. Created with BioRender.com. Yeast-mediated...nicks that bacteria repair after transformation. LIC does not require site-specific recombination or a...making it an easy, cheap, and rapid cloning method. LIC depends on the addition of only one free dNTP to ...interest and then insert them into plasmids for replication and protein expression. There are many methods... 101: Sequence and Ligation Independent Cloning (SLIC) More Plasmids 101 topics More Plasmids cloning ...
  2. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...potential formation of replication-competent viruses. While AAV themselves are replication incompetent, there...production of replication-competent viruses that would be able to infect cells and replicate autonomously... actively causing symptoms or replicating. Lytic cycle Viral replication process where the virus uses ...into cells. Replication-competent rAAV Mutated rAAV vector that has the ability to replicate and reproduce.... The Rep region encodes four non-structural replication proteins (Rep78, Rep68, Rep52, and Rep40), which...which are involved in genome replication and viral packaging. The Cap region encodes three structural ...virus. The ITR sequences serve as origins of replication and also act as signals for packaging. Figure...
  3. Adenovirus Guide

    Type
    Guide
    ... DNA replication and host cell manipulation. Late transcripts are expressed after DNA replication starts...production of replication-competent adenoviruses (RCAs) that would be able to infect cells and replicate autonomously...26–45 kb in length and contain multiple heavily-spliced transcripts flanked by two inverted terminal repeats..., which has limited their use in therapeutic applications. However, this has also made them the most widely...presence of adenoviral genes E1, E4, E2a and VA for replication. For more information about AAVs, read our AAV...whereas the E1 region is essential for viral replication and therefore needs to be supplied through other...due to their well-established methods, relative simplicity of production, and higher titers. However, the...
  4. Molecular Biology Reference

    Type
    Guide
    ...process of DNA replication in vitro. During replication, the DNA helix is unwound by a helicase, the enzyme...Origin of Replication ( ori ) DNA sequence which directs the initiation of plasmid replication in bacteria...that typically carry genetic information and can replicate independently from chromosomal DNA. Although they...conjugation. Like chromosomal DNA, plasmid DNA is replicated upon cell division, and each daughter cell receives...genetic element that you are interested in. Self-replicate — Once you have constructed a plasmid, you can...exhibit exponential growth rates, plasmids can be replicated easily and efficiently in a laboratory setting...mice, and cultured human cells. Have diverse applications — Although plasmids were originally used to ...
  5. Antibody Guide

    Type
    Guide
    ...single assay. Overview of Antibody Applications Antibody-based applications can be generally classed into ...these applications, visit the Antibody section of the Addgene Protocols page. Antibody Applications - Quantification...production and storage techniques, and explain common applications. Science... Handling Visualization Signal Amplification Application Overview Quantification Methods Capture Methods...of other antibodies. This has useful research applications, and is covered in the following Isotypes section...signaling molecules and are often used in clinical applications. Diabodies - Diabodies contain two Fab fragments... molecules that can be distinguished in your application. The indirect detection method uses an unconjugated...
  6. CRISPR Guide

    Type
    Guide
    ...Experiment Web References PAM Sequences Glossary Publications CRISPR Overview Bacteria have an interesting... every genomic target. Due to its comparative simplicity and adaptability, CRISPR rapidly became the most... to various Cas enzymes have extended CRISPR applications to increasingly complex functions, including...understanding of CRISPR biology, introduce the various applications of CRISPR, and help you get started using CRISPR... Cas12a, which are available for specialized applications. Check out our list of additional Cas proteins...genomic edits carried out by Cas9. Multiplexing applications include editing multiple genes at once; using...to help you select an optimized gRNA for your application (see: gRNA Design Software ). In addition to ...
  7. Lentiviral Vector Guide

    Type
    Guide
    ... Rev Response Element (RRE) within unspliced and partially spliced transcripts to facilitate nuclear export...and tropism. Replication-competent The ability of a virus (or viral vector) to replicate and reproduce...hosts in order to continue their lifecycle and replicate. This feature can be harnessed for stable delivery...of safety improvements and the potential for replication-competent lentivirus production — that is, creation...particles that could infect cells and further replicate on their own. While the viral components are still...Interchangeable; usually encodes for VSV-G Safety Safe; replication incompetent by using three separate plasmids ...plasmids encoding the necessary viral genes Safer; replication incompetent by using four plasmids instead of ...
  8. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...and tropism. Replication-competent The ability of a virus (or viral vector) to replicate and reproduce...hosts in order to continue their lifecycle and replicate. This feature can be harnessed for stable delivery... for safety to reduce the chance of creating replication-competent retroviruses. For a summary of all ...retroviral vectors are commonly used in gene therapy applications to more specifically direct delivery of gene...vectors are a popular choice in gene therapy applications. There are many approved gamma-retroviral gene...cell (CAR-T) therapy is a particularly popular application of gamma-retroviral vectors. Gamma-retroviral...vectors are: The potential for generation of replication-competent gamma-retroviral vectors The potential...
  9. Modular Cloning Guide

    Type
    Guide
    ...a variety of applications—like building synthetic genetic circuits, engineering metabolic pathways, assembling...Modular Cloning Blog: Plasmids 101 Modular Cloning Applications and Kits Blog: Plasmids 101 Golden Gate Cloning...editing, functional genomics, and more complex metabolic engineering and synthetic biology, compatible ...proteins for use in E. coli for a variety of applications. EcoFlex MoClo Extension, Volume I Bacterial... vectors for use in E. coli for a variety of applications. CIDAR MoClo Parts Kit Bacterial Expression ...toolkit with both high cloning capacity and vector simplicity, compatible with other MoClo, GoldenBraid, and...multi-part assemblies in either integrative or self-replicating plasmid vectors for working in cyanobacteria....
  10. Guide to Using Pooled Libraries

    Type
    Guide
    ...semi-random or random sequences that can be used for applications like lineage tracing, drug screening, and gene...efficiency (activation/inhibition) Essential genes may complicate knockout screens Requires Cas machinery, which... screens, cells are transduced at a very low multiplicity of infection (MOI) to increase the odds that...of each cell carrying it as being a biological replicate for that plasmid. Library screens can be divided...
  11. Addgene's eBook Collection

    Type
    Guide
    ...contains an introduction to each vector and its applications, tips for using vectors in your experiments,...your transferable skills, and tips on the job application process. Close About Overlay Select CRISPR 101...introductions and helpful tips for antibody-based applications, from flow to IHC! Close About Overlay 0 of ...
  12. Plan Your Experiment

    Type
    Guide
    ...component for each category. Genetic Manipulation Application Cas Enzyme Additional Considerations Browse Plasmids...gene you target will depend on your specific application. Knockout : Target constitutively expressed regions...region is removed from the mRNA due to alternative splicing, and an early frameshift mutation is more likely...
  13. Sequencing Primers

    Type
    Guide
    ...SV40 promoter/origin Forward SV40-spliceR CACAAAGATCCGGACCAAAG SV40 splice sequence Reverse T3 GCAATTAACCCTCACTAAAGG...
  14. Chemogenetics Guide

    Type
    Guide
    ...neurons) that can be turned on or off by the application of a small molecule ligand. The ideal chemogenetic...chemogenetics for research and potential clinical applications. Science, 364 (6436), eaav5282. https://doi....
  15. Optogenetics Guide

    Type
    Guide
    ...from A. thaliana is fused to truncated forms of cytosolic STIM1 to control calcium channels ~488 LOV Domains...Methods section of the original report or recent publications using your chosen tool for more details. When...
  16. Educational Resources

    Type
    Guide
    ...written and video protocols for a wide range of applications in molecular biology, plasmid cloning, and virus...
  17. Science Guides

    Type
    Guide
    ...specific binding to other proteins. Antibody-based applications, which often use antibodies conjugated to a ...
  18. Promoters

    Type
    Guide
    ...Inducible by arabinose Promoter of the arabinose metabolic operon trp Repressible by tryptophan Promoter ...
Showing: 1 - 18 of 18 results