We narrowed to 18 results for: prot

...done using Protein A, Protein G, or the recombinant Protein A/G, which are bacterial proteins that bind...amounts of protein. Includes: Western blot ELISA Capture - used to isolate specific proteins or protein complexes...quantify, identify, separate, and locate proteins of interest. The protein that an antibody recognizes is called...binding to a specific configuration of a protein or a protein:protein complex. Due to their increased manufacturing...genetically engineered small proteins derived from ankyrin repeat proteins. These are antibody mimics instead...to the protein of interest. Signal strength is determined by how many antibodies bind the protein of interest...amounts of protein. Western blot Western blots use antibodies to identify denatured proteins separated ...

...ll express your gRNA and Cas9 protein, which will form a ribonucleoprotein complex through interactions...naturally-occurring Acr (Anti-CRISPR) proteins can help control CRISPR activity. Acr proteins have evolved in phages ..., or inducing degradation of the Cas9 protein. Most Acr proteins are specific to a particular type of ...and antibody-activator effector proteins; long-term imaging of proteins in living cells (Figure 9B) dCas9...with different fluorescent proteins or by fusing the gRNAs to orthogonal protein-interacting RNA aptamers...edition) CRISPR software and depositor protocols Video protocol for genomic deletions in mammalian cell...applicability of base editing through protein engineering and protein delivery. Nature Communications . 8...

...release proteins from cellular membranes using light. light-induced protein dissociation using protein A fragments...photoreceptors to create protein systems controlled by light. These "photoswitchable" proteins offer exquisite ...of a protein of interest. A genetically-encoded nuclear Cry2 fusion can thus direct a CIB1-protein fusion...Inhibits protein function by reversibly sequestering targets into large, optically assembled protein architectures...transcription using engineered zinc finger proteins, using proteins GIGANTEA (GI) and the light oxygen voltage...pair to the target protein, and the other to the membrane where the target protein is to be sequestered...associate and cage a protein in the dark, while dissociate and activate the protein in the light ~400 (...

...truncated protein. Targeting an exon coding for an essential protein domain could abolish protein activity...review the protocol associated with the specific plasmid in question (see CRISPR protocols from Addgene...modified mouse lines. Protein delivery Lastly, you can deliver Cas-gRNA ribonucleoprotein (RNP) complexes directly...to translate mRNA to protein. Instead, you directly combine purified Cas protein and in vitro transcribed...Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and...our CRISPR Guide . There are many different Cas proteins available, and researchers can adapt these experiments...a DNA donor template Cas9 or Cas9 fusions with proteins that promote HDR Requires a repair template Lower...

...region encodes three structural capsid proteins or viral proteins (VP1, VP2 and VP3) that form the icosahedral... models. For more detailed protocols, see Addgene’s Viral Vector Protocols . Figure 3: Overview of rAAV... split inteins, proteins that carry out a naturally occurring process known as protein trans-splicing....viral capsid proteins VP1, VP2, and VP3, which together form the outer capsid shell that protects the viral... the viral particle and are only composed of a protein capsid and the viral genetic material inside. The...region encodes four non-structural replication proteins (Rep78, Rep68, Rep52, and Rep40), which are involved...chromosome 19. This integration is mediated by proteins Rep78 and Rep68, which can bind to specific Rep-binding...

...the instructions to make every protein within an organism. Before proteins can be translated, the DNA is...RNA (mRNA), which is then translated into proteins. Proteins are made up of amino acids. Each amino acid...discoveries led to the conclusion that genes encode proteins and reside on chromosomes, which are composed ...in the central dogma of molecular biology, that proteins are translated from RNA, which is transcribed ...translating the information encoded by DNA and RNA into proteins. DNA is comprised of four nucleotide bases: adenine...by uracil (U). Not all regions of DNA code for proteins. In fact, most DNA is non-coding. These regions...processes and gene regulation. Regions that code for proteins are transcribed and processed into mature messenger...

...viral titer. For more detailed protocols, see Addgene’s viral vector protocols . Production Using Packaging...information in Addgene’s stable cell line protocol . Addgene’s protocol is for lentiviral vectors, but a similar...Addgene protocols Generating Stable Cell Lines Using Lentiviral Vectors Addgene's Viral Protocols References... vesicular stomatitis virus G glycoprotein (VSV-G), an envelope protein with broad tropism used to pseudotype...infectivity VSV-G (vesicular stomatitis virus G protein) is the most common envelope gene, due to a wide...enhancers. Many times, integration sites are found in proto-oncogenes. This can lead to activation of the oncogene...transduction Murine Leukemia Virus (MuLV) and HIV glycoprotein — CD4+ cell transduction Pseudotyped retroviral...

...transgene. For more detailed protocols, see Addgene’s viral vector protocols . Figure 5: Overview of lentiviral...Ebola glycoprotein — transduce airway epithelium and cardiomyocytes in utero Rabies glycoprotein — transduce...Lentiviral Vector topics Addgene Protocols pLKO.1 - TRC Cloning Vector Protocols Lentiviral Vector Production...the Rev protein binds. Psi (Ѱ) in cis RNA packaging signal; recognized by nucleocapsid proteins and essential... vesicular stomatitis virus G glycoprotein (VSV-G), an envelope protein with broad tropism used to pseudotype...infectivity) VSV-G (vesicular stomatitis virus G protein) is the most common envelope gene in all systems...vectors can be found in Addgene’s stable cell line protocol . Browse Addgene's collection of in-stock lentiviral...

...fluorescence complementation experiments to analyze protein-protein interactions in plants. MoClo-YTK Yeast Expression..., synthetic terminators, protein purification tags and fluorescence proteins for use in E. coli for a ...plasmids including backbones, fluorescent proteins, protein tags, and signal peptides, for use in a range...example, a promoter, a 5' UTR, a signal peptide, a protein-coding gene, and a terminator, as in Figure 1)....optimize secretion and cell surface display of proteins of interest. Yeast Secrete and Detect Yeast Expression...Marillonnet Plasmids to generate transcription units for protein secretion in yeasts S. cerevisiae and P. pastoris... in combination with the MoClo-YTK toolkit for protein expression and secretion in P. pastoris (a.k.a....

...transmembrane proteins that bind a specific ligand. Ligand binding then activates G-proteins to modulate...The first chemogenetic receptors were based on G-protein coupled receptors (GPCRs) . The largest class of...DREADDs), like RASSLs, are based on engineered G-protein coupled receptors, but unlike RASSLs, show insensitivity...that can be broadly classified by the signaling protein that the receptors couple to: Gq-DREADDs Gq-DREADDs...Gq-DREADDs signal through the Gαq/11 G-protein and activate neuronal firing through stimulating phospholipase...-DREADDs Gi-DREADDs signal through the Gαi/o G-protein and inhibit neuronal signaling by inhibiting adenylate...Gs-DREADDs Gs-DREADDs signal through the Gαs G-protein and activate neuronal signaling by increasing intracellular...

...factors, and other accessory proteins (such as activators and structural proteins) make up the transcription...Ribosomes are the site of protein syntehsis where mRNA is translated into a protein. RNA polymerase II — transcribes...which is ultimately translated into a functional protein. Thus, the promoter region controls when and where...transcription factors. Transcription factors are proteins which recruit RNA polymerase and control and regulate... can be either negative or positive. Repressor proteins bind to negative-repressible operons and prevent...within the core promoter region. The TATA-binding protein binds the TATA box and helps in the subsequent ...polymerase. General transcription factors and histones (proteins that package DNA into nucleosomes) also bind the...

...AdEasy system . Nature Protocols, 2 (5), 1236–1247. https://doi.org/10.1038/nprot.2007.135 (Link opens ... the viral particle and are only composed of a protein capsid and the viral genetic material inside. Adenoviral...after the virus enters the host cell, and encode proteins necessary for viral DNA replication and host cell...replication starts and primarily encode for structural proteins needed to assemble icosahedral capsids and build...viral vectors in combination with foreign capsid proteins. Researchers have further refined the tropism ...provide a large transgene packaging capacity. Large protein-coding genes and complex gene expression cassettes...Ad35 vaccine vectors bypass immunity to Ad5 and protect nonhuman primates against ebolavirus challenge ...

...including protocols, tips on using Addgene’s materials, and career advice. Playlists include: Protocols Careers... Molecular Cloning Techniques Protocols Find written and video protocols for a wide range of applications...videos, and protocols Educational... Educational Resources From eBooks to videos and blog posts to protocols, our educational...Plasmids 101 CRISPR 101 Viral Vectors 101 Fluorescent Proteins 101 Science Career Guide Videos Watch our collection...Topics include: Genome Engineering Fluorescent Proteins CRISPR Viral Vectors Plasmid Technology Career...

...Select Fluorescent Proteins 101 August 2017 | First Edition About Fluorescent Proteins 101 August 2017...choosing a fluorescent protein; information on FRET, biosensors, and monitoring protein localization; an introduction... introduction to non-protein fluorophores; and much more! Close About Overlay Select Viral Vectors 101...

...system, antibodies are proteins capable of highly specific binding to other proteins. Antibody-based applications...can be used to capture, quantify, and identify proteins of interest. Read More Chemogenetics Chemogenetics...

...Library Amplification Protocol for Addgene's generalized library amplification protocol. Read our CRISPR guide...amplify the library, please refer to the depositor’s protocol for the best results. For some libraries, plasmid...

... annotated primers. You can also use Addgene’s protocol to design your own primers . Still have questions...GATGAAGCCCTGAAAGACGCGCAG 3' end of maltose binding protein Forward mCherry-F CCCCGTAATGCAGAAGAAGA 3' end of...AAGATGCAGGCAGCTGAGTT HCMV major immediate-early protein (IE) Forward pMT2-F TTGCCTTTCTCTCCACAGGT 3' end...

... insert them into plasmids for replication and protein expression. There are many methods that allow you...promoters, tags, selection markers, and fluorescent proteins to fit a variety of experimental conditions. Read...Plasmid Backbone Genome Eengineering Guide Addgene Protocols Plasmid cloning by restriction digest Plasmid ...