We narrowed to 2,961 results for: COB;
-
Plasmid#60268PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only
-
pGL4.23 C3_31
Plasmid#60310PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertSLC2A2 enhancer (SLC2A2 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_21
Plasmid#60296PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertCDKN2BAS enhancer (CDKN2B-AS1 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_19
Plasmid#60302PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertTHADA enhancer (THADA Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
UseTagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
CL20_MSCV-ires-GFP
Plasmid#237496PurposeRetroviral empty vectorDepositorTypeEmpty backboneUseRetroviralTagsExpressionMammalianMutationPromoterAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
EFS-SpdCas9-Dnmt3A/3L-V1
Plasmid#222498PurposeExpresses EFS promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V1 (R887E) followed by P2A-mCherryDepositorInsertS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V1 (R887E) engineered fusion
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; R887E in Dnmt3APromoterEFSAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
EFS-SpdCas9-Dnmt3A/3L-V2
Plasmid#222499PurposeExpresses EFS promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V2 (E814G) followed by P2A-mCherryDepositorInsertS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V2 (E814G) engineered fusion
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; E814G in Dnmt3APromoterEFSAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
EFS-SpdCas9-Dnmt3A/3L-V3
Plasmid#222500PurposeExpresses EFS promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V3 (R887E and E814G) followed by P2A-mCherryDepositorInsertS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V3 (R887E and E814G) engineered fusion
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; R887E and E814…PromoterEFSAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3GV-SpdCas9-Dnmt3A/3L-V1
Plasmid#222503PurposeExpresses TRE3GV promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V1 (R887E) and hPGK promoter driven mCherryDepositorInsertsS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V1 (R887E) engineered fusion
mCherry
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; R887E in Dnmt3APromoterTRE3GV and hPGKAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3GV-SpdCas9-Dnmt3A/3L-V2
Plasmid#222505PurposeExpresses TRE3GV promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V2 (E814G) and hPGK promoter driven mCherryDepositorInsertsS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V2 (E814G) engineered fusion
mCherry
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; E814G in Dnmt3APromoterTRE3GV and hPGKAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3GV-SpdCas9-Dnmt3A/3L-V3
Plasmid#222506PurposeExpresses TRE3GV promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V3 (R887E and E814G) and hPGK promoter driven mCherryDepositorInsertsS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V3 (R887E and E814G) engineered fusion
mCherry
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; R887E and E814…PromoterTRE3GV and hPGKAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3GV-SpdCas9-Dnmt3A/3L-catΔ
Plasmid#222508PurposeExpresses TRE3GV promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant catΔ (C706A and R832E) and hPGK promoter driven mCherryDepositorInsertsS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant catΔ (C706A and R832E) engineered fusion
mCherry
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; C706A and R832…PromoterTRE3GV and hPGKAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNES-SET-EMD-EGFP (C-NES-SET-EMD)
Plasmid#217770PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorInsertSET (SET Human)
UseTagsEGFPExpressionMammalianMutationEMD domain (aa 70-226) plus nuclear export sequen…PromoterCMVAvailable SinceJune 12, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
p2X-KSR1-CA3-EGFP (2x-C-KSR)
Plasmid#217756PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
UseTagsEGFPExpressionMammalianMutationTwo tandem CA3 domain (aa 317-400) 1st linker GG…PromoterCMVAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
CL20_mEGFP_ZKSCAN5_SMO
Plasmid#205960PurposeExpress mEGFP-tagged fusion protein, ZKSCAN5_SMO from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_TRIOBP_RBFOX2
Plasmid#205947PurposeExpress mEGFP-tagged fusion protein, TRIOBP_RBFOX2 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_SEMA6C_DLG2
Plasmid#205919PurposeExpress mEGFP-tagged fusion protein, SEMA6C_DLG2 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_SETD2_CCDC12
Plasmid#205920PurposeExpress mEGFP-tagged fusion protein, SETD2_CCDC12 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_SNTB2_ZCRB1
Plasmid#205924PurposeExpress mEGFP-tagged fusion protein, SNTB2_ZCRB1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only