We narrowed to 9,684 results for: CAG
-
Plasmid#45528DepositorInsertPKA catalytic subunit alpha tagged by mEGFP
UseWith chicken beta actin promoter and wpreExpressionMammalianAvailable SinceJune 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR
Plasmid#68345PurposeA Sleeping beauty transposon with conditional expressed hCas9. A red flourescent gene linked to puromycin can be removed in the prescence of Flp recombinase allowing Cas9 expressionDepositorInsertspuromycin
hCas9
UseCRISPR; Flp/frtTagslinked to red flouresent protein gene mKateII and…ExpressionMammalianPromoterCAGAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-HSD17B11
Plasmid#161923PurposeTo generate HSD17B11 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against HSD17B11 exon 1.DepositorInsertsgRNA targeting HSD17B11 exon 1
UseCRISPRPromoterU6Available SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-Flag-hsDicer (Y971A/Y972A)
Plasmid#41590DepositorAvailable SinceFeb. 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-mTagBFP2-T2A-iCreERT2 (PAGSAS)
Plasmid#137864PurposeMonomeric TagBFP2 and iCre-ERT2 recombinase (PAGSAS N-terminus)DepositorInsertmTagBFP2-T2A-iCreERT2
UseCre/LoxExpressionMammalianAvailable SinceMarch 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-ULK1 (836-1050)-MBP
Plasmid#203562PurposeMammalian expression of ULK1 (836-1050) with MBP tagDepositorAvailable SinceJuly 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mCherry-FKBP-GEF(ITSN1)
Plasmid#222631PurposeCdc42 activation using rapamycinDepositorAvailable SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Cas12i-Max-T2A-EGFP
Plasmid#188268PurposeMammalian expression, Genome editingDepositorInsertCas12i-Max
UseCRISPRExpressionMammalianMutationnonePromoterCAGAvailable SinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Cas12i-HiFi-T2A-EGFP
Plasmid#188269PurposeMammalian expression, Genome editingDepositorInsertCas12i-HiFi
UseCRISPRExpressionMammalianMutationnonePromoterCAGAvailable SinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-miRFP720-P2A-GFP
Plasmid#197165PurposeExpresses the protein of miRFP720-P2A-GFP in mammalian cellsDepositorInsertmiRFP720-P2A-GFP
UseAAVAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMX-CAG-CD3-P2A-CD90.2
Plasmid#163336PurposeRetroviral vector to overexpress the murine CD3 (TCR) components CD3 gamma, CD delta, CD epsilon and TCR zeta and surface marker CD90.2, separated by T2; F2A; E2A; P2A respectively, under control of the CAG promoterDepositorInsertCD3
UseRetroviralExpressionMammalianPromoterCAGAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CAG-NCreIntN-EF1a-mTagBFP2
Plasmid#160507PurposeExpresses NCreIntN in mammalian cells in split intein-mediated split-Cre recombinase applicationsDepositorInsertNCreIntN
UseCre/Lox and LentiviralTagsmTagBFP2ExpressionMammalianPromoterCAGAvailable SinceJan. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-SNIFP-P2A-GFP
Plasmid#197157PurposeExpresses the protein of SNIFP-P2A-GFP in mammalian cellsDepositorInsertSNIFP-P2A-GFP
UseAAVAvailable SinceMarch 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT/Caggs-NRAS G12V-IRES-ASK1
Plasmid#221074PurposeExpresses NRAS G12V and ASK1 in mammalian cellsDepositorAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-DD-3xFLAG-hSOX17-GS-TagBFP-BGHpA
Plasmid#172226PurposeExpression vector with Shield-1 stabilizable hSOX17 fused to TagBFP.DepositorInsertSOX17 (SOX17 Human)
UsePiggybac transposonTags3XFLAG, DD-domain, GS-linker, and TagBFPExpressionMammalianPromoterCAGAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-miniSOG-T2A-dTomato
Plasmid#193796PurposeExpresses miniSOG in the cytosol of mammalian cells, joined by a T2A cleavage site with dTomatoDepositorInsertminiSOG
UseAAVTagsFlag tagExpressionMammalianPromoterCAGAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB CAG-F-intron-L-F-bpA-SV40pA-L-td-sfGFP
Plasmid#178433PurposeCAG tdGFP FLP/FRT cre/lox "NOT" reporter piggyBac transposon (bpA SV40pA stop)DepositorInserttd-sfGFP
UseCre/Lox; Flp/frt, piggybacExpressionMammalianAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-FLAG-IRES-Blasticidin-hOCT4 WT
Plasmid#198764PurposeMammalian expression of hOCT4DepositorAvailable SinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-rat PKA-RIIbeta-mEGFP
Plasmid#45530DepositorInsertPKA regulatory subunit RII beta tagged by mEGFP
UseWith chicken beta actin promoter and wpreExpressionMammalianAvailable SinceJune 12, 2013AvailabilityAcademic Institutions and Nonprofits only