We narrowed to 16,166 results for: grna
-
Plasmid#91149PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA , Plant Selection: PvUbi2:barDepositorInsertEngineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA
UseCRISPRExpressionPlantMutationD10A, H840AAvailable sinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_21B
Plasmid#91129PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:AtCas9_dead + AtU6:gRNA, Plant Selection: 2x35S:hpt IIDepositorInsertEngineering Reagent: 35S:AtCas9_dead + AtU6:gRNA
UseCRISPRExpressionPlantMutationD10A, H840AAvailable sinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSmad4#1/Cre
Plasmid#173617PurposeExpresses a Smad4-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Smad4 (Smad4 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCmtr2#2/Cre
Plasmid#173632PurposeExpresses a Cmtr2-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Cmtr2 (Ftsjd1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgFat1#1/Cre
Plasmid#173633PurposeExpresses a Fat1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Fat1 (Fat1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CRISPR-v2-gYap-1
Plasmid#166481PurposeExpresses spCas9 and a gRNA targeting mouse YapDepositorInsertgRNA for mouse Yap (Yap1 Mouse)
UseLentiviralAvailable sinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
CIRTS-YTHDF2-Malat1
Plasmid#216858PurposeCIRTS RNA targeting system for targeted knockdown of m6A-containing Malat1 at the synapse. CIRTS-YTHDF2-Calm3 and Malat1 gRNA is expressed under human Syn1 and U6 promoter, respectively.DepositorInsertCIRTS-YTHDF2-Calm3-U6-Malat1 gRNA
UseLentiviralTagsGFPExpressionMammalianPromoterSyn1, U6Available sinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
CIRTS-FTO-Malat1
Plasmid#216860PurposeCIRTS RNA targeting system for targeted removal of m6A on Malat1 at the synapse. CIRTS-FTO-Calm3 and Malat1 gRNA is expressed under human Syn1 and U6 promoter, respectively.DepositorInsertCIRTS-FTO-Calm3-U6-Malat1 gRNA
UseLentiviralExpressionMammalianPromoterSyn1, U6Available sinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9N-U6-gRNA TdR
Plasmid#80940PurposeExpresses Cas9N in mammalian cells; expresses gRNA TdR for Ai9 cleavage.DepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable sinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2 hBAK
Plasmid#129579PurposeCRISPR deletion of human BAKDepositorAvailable sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSpCas9-2A-Puro-TBK1-gRNA (PX459)
Plasmid#221550PurposeExpresses Cas9 and gRNA for disruption of TBK1 gene in human cellsDepositorAvailable sinceJuly 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_cassette-Nme/Nme2Cas9-sgRNA (KAC32)
Plasmid#133794PurposeU6 promoter sgRNA entry vector used for all NmeCas9 or Nme2Cas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to sgRNA architecture from Amrani et al. Genome Biology 2018DepositorInsertNmeCas9 and Nme2Cas9 sgRNA entry vector
ExpressionMammalianMutationsgRNA architecture from Amrani et al. Genome Biol…PromoterU6Available sinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDR366 RNF2
Plasmid#47509Purposehuman gRNA expression vector targeting RNF2DepositorAvailable sinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_PROX1_1+4
Plasmid#121177PurposeLentiviral construct for the expression of Cas9 protein and puromycin resistance from EFS promoter and two guide RNAs targeting for deletion PROX1 start codon sequence.DepositorInsertCas9-P2A-puro and U6 promoters driven expression of gRNAs
UseCRISPR and LentiviralTagsP2A-puroExpressionMammalianAvailable sinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_10E
Plasmid#91209PurposeDirect Cloning, Type: non-T-DNA, Engineering Reagent: 35S:AtCas9 + CmYLCV:gRNAs with tRNA spacers , Plant Selection: noneDepositorInsert35S:AtCas9 + CmYLCV:gRNAs with tRNA spacers
UseCRISPRExpressionPlantAvailable sinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pVMG0302_Cq-U6-1_2xBbsI_gRNA-Loop
Plasmid#169369PurposeExpression of gRNA in Culex quinquefasciatus or other mosquitoesDepositorInsertpVMG0302_Cq-U6-1_2xBbsI_gRNA-Loop
UseCRISPRExpressionInsectPromoterCPIJ039653Available sinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_PRKRA
Plasmid#106109PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting PRKRADepositorInsertgRNA targeting PRKRA (PRKRA Human)
UseCRISPRAvailable sinceFeb. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_ELAVL2
Plasmid#106107PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting ELAVL2DepositorInsertgRNA targeting ELAVL2 (ELAVL2 Human)
UseCRISPRAvailable sinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAK008
Plasmid#128225Purposeclassic sgRNA backbone for tRNA-gRNA array, Position 2DepositorInsertclassic sgRNA backbone for tRNA-gRNA array, Position 2
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only