We narrowed to 14,273 results for: cas9
-
Plasmid#246938PurposeGmWUS along with RUBY for soybean genome editingDepositorInsertGmWUS, Cas9, RUBY
UseCRISPRExpressionPlantPromoterNOS, AtUbi10Available SinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRGE31
Plasmid#50929PurposeExpressing sgRNA and Cas9 in plants. The sgRNA was controlled by rice snoRNA U3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRice snoRNA U3 and dual 35S promoterAvailable SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAGT6471
Plasmid#219428PurposeModule of intronized NLS-SpCas9-NLS for N-terminal and C-terminal tag fusions (AGGT_N-SpCas9i-N_TTCG)DepositorInsertAGGT_NLS-SpCas9i-NLS(no stop)_TTCG
UseMoclo compatible level 0 moduleAvailable SinceJuly 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV8-cPE-N
Plasmid#183538PurposeDeliver a split compact Prime Editor in vivoDepositorInsertN-terminal fragment of SpCas9 nickase (H840A)
UseAAVExpressionMammalianAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICSL90016
Plasmid#117514PurposeCas9_2 Golden Gate Level 0DepositorInsertBsaI:AATG:Cas9_2:GCTT:BsaI
UseCRISPRTagsNLS_SV40ExpressionPlantAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-CBE6c-V106W
Plasmid#215826PurposeExpress CBE6c V106W (with SpCas9) in mammalian cellsDepositorInsertCBE6c V106W-SpCas9-2xUGI (cas9 )
UseIn vitro transcription templateAvailable SinceMarch 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTLN1 exon
Plasmid#176033PurposeA vector for the CRISPR-Cas9 system targeting an exon of dog TLN1 (talin1)DepositorInsertA gRNA targeting the dog TLN1 gene and the cDNA of Cas9 (TLN1 )
UseCRISPRExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTLN1 intron
Plasmid#176224PurposeA vector for the CRISPR-Cas9 system targeting an intron of dog TLN1 (talin1)DepositorInsertA gRNA targeting the dog TLN1 gene and the cDNA of Cas9 (TLN1 )
UseCRISPRExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pK237.U6-Chimeric-CAG-loxP-stop-loxP-hspCas9 (Supernova)
Plasmid#85041PurposeThis plasmid should be used for Cre/loxP-based Supernova-CRISPR/Cas9.DepositorInsertloxP-stop-loxP
UseCRISPRExpressionMammalianAvailable SinceNov. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
MTK0_046
Plasmid#123976PurposeEncodes the Cas9 Thal5.10-2_hg18 homology destination with Hygromycin resistance cassette GFP dropout destination vector as a type 0 part to be used in the MTK systemhDepositorInserthThal5.10-2_hg18 CAS9 Destination - HygroR
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCjedCas9
Plasmid#172216PurposeExpresses catalytically inactive Campylobacter jejuni Cas9 (CjedCas9) in bacterial cellsDepositorInsertcatalytic mutant of Cas9 endonuclease from the Campylobacter jejuni Type II CRISPR/Cas system
TagsHistagMutationchanged Asp 8 to Ala and His 559 to AlaAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_3
Plasmid#155083PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAWP78-PVCpnf_pvc13-Ad5_pvc10-Cas9
Plasmid#243733PurposePVC structural operon - tail fiber (Pvc13) retargeted with Ad5 knob - spike tip (Pvc10) loaded with Cas9 on CTDDepositorInsertpvc13-Ad5_pvc10-Cas9
ExpressionBacterialAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
CRISPi Kit
Plasmid Kit#1000000136PurposePlasmids for performing CRISPR/Cas9 mediated gene and genome editing in Pichia pastoris.DepositorApplicationGenome EditingVector TypeYeast ExpressionEditing TypeCRISPRAvailable SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
1098E=TI-pgSIT[tra,bTub,Hasp70Bb-Cas9]
Plasmid#149427PurposeThe attB plasmid with the mini-white harboring two U6.3-gRNAs targeting Dmel tra and bTub genes, and Hsp70Bb-Cas9-T2A-eGFP-p10.DepositorInsertsU6.3-gRNAs[TraB, bTub]
Hsp70Bb-Cas9-T2A-eGFP-p10
UseCRISPRTagseGFPExpressionInsectAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDe_Cas9_KANA_R160a
Plasmid#173756PurposeBinary expression vector with A.th. codon-optimized Cas9 and sgRNA for miRNA160aDepositorInsertCas9_sgRNA1/R160a_sgRNA2/R160a
UseCRISPRPromoterAtU6 &StU6Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDe_Cas9_KANA_R160b
Plasmid#173757PurposeBinary expression vector with A.th. codon-optimized Cas9 and sgRNA for miRNA160bDepositorInsertCas9_sgRNA1/R160b_sgRNA2/160b
UseCRISPRPromoterAtU6 &StU6Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDe_Cas9_KANA_R390a
Plasmid#173758PurposeBinary expression vector with A.th. codon-optimized Cas9 and sgRNA for miRNA390aDepositorInsertCas9_sgRNA1/390a_sgRNA2/390a
UseCRISPRPromoterAtU6 &StU6Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pICSL1P1_AtU626Ter26
Plasmid#191769PurposeCas9 guide expression in dicotsDepositorInsertSpCas9 guide scaffold with AtU626 promoter/terminator
UseCRISPRExpressionPlantAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only