We narrowed to 10,209 results for: cas9 expression plasmid
-
Plasmid#112400PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF434DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pZNF165.2.0-gDNA
Plasmid#112398PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF165DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF174.1.0-gDNA
Plasmid#112397PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF174DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF764.1.0-gDNA
Plasmid#112394PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF764DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF57.1.0-gDNA
Plasmid#112392PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF57DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF257.1.0-gDNA
Plasmid#112390PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF257DepositorAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
BB3nK_ext_AC
Plasmid#108686PurposePlasmid for assembly of donor DNA templates consisting of two expression unitsDepositorTypeEmpty backboneExpressionBacterial and YeastAvailable SinceAug. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
BB3nK_ext_AD
Plasmid#108687PurposePlasmid for assembly of donor DNA templates consisting of three expression unitsDepositorTypeEmpty backboneExpressionBacterial and YeastAvailable SinceAug. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9 probasin_mTQ2_FlpO
Plasmid#68357PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and 8, and SMAD4 ex2 and ex 9 are expressed by the U6 promoter.DepositorInserts5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterU6 and synthetic Probasin ARRx2Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUC gRNA Shuttle
Plasmid#47024PurposeEncodes a template from which gRNAs can be made via InFusion cloning. The Medicago truncatula U6.6 promoter drives the gRNA. For use in plants.DepositorInsertgRNA Shuttle
UseCRISPR; Cas9ExpressionPlantMutationG to T cloning mutation at position 323PromoterMedicago truncatula U6.6Available SinceSept. 3, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEG302 22aa SunTag NtDRMcd (noNLS) nog
Plasmid#119554PurposeCRISPR-Cas9 SunTag system to target NtDRMcd (without an NLS) to specific loci of interest (nog=no guide)DepositorInsertNOS_NLS_GB1_noNLS_linker_DRMcd_linker sfGFP_scFv_UBQ10_Insulator UBQ10_Ω dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag NtDRMcd g4+g10+g18 (FWA)
Plasmid#115487PurposeCRISPR Cas9 SunTag system to target NtDRMcd to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_NOS_NLS_GB1_NLS_linker_DRMcd_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-mGreenLantern/EGFP
Plasmid#179913PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern and EGFP fluorescent proteins.DepositorInsertmGreenLantern/EGFP sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag NtDRMcd (no NLS) SUP
Plasmid#115490PurposeCRISPR-Cas9 SunTag system to target NtDRMcd (without an NLS) to the SUPERMAN locus with two guide RNAsDepositorInsertg2_U6_g1_U6_NOS_NLS_GB1_noNLS_linker_DRMcd_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-tdTomato90/816
Plasmid#179918PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 90 and 816.DepositorInserttdTomato sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEG302 5aa SunTag VP64 g4+g17 (FWA)
Plasmid#119672PurposeCRISPR-Cas9 SunTag system to target VP64 to the FWA locus with two guide RNAsDepositorInsertg17_U6_g4_U6_NOS_NLS_GB1_NLS_linker_VP64_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_2xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-tdTomato166/892
Plasmid#179919PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 166 and 892.DepositorInserttdTomato sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX300A-G+Nanog
Plasmid#140280PurposeCRISPR/Cas9 plasmid encoding Cas9 and sgRNA against gBait and Nanog locusDepositorInsertCas9
ExpressionMammalianPromoterCBHAvailable SinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPtGE35
Plasmid#107999PurposeExpresses TevCas9 in Phaeodactylum tricornutum / Encodes elements required for conjugationDepositorInsertsOriT
40SRPS8 Promoter
ShBle
40SRPS8 Terminator
Cen6-ArsH4-His3
I-TevI nuclease and partial linker domain
UseCRISPR and Synthetic Biology; Episomal vector for…TagsCas9Available SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only