We narrowed to 36,941 results for: kan
-
Plasmid#127058PurposeLow phosphate inducible mCherry with N-terminal linker and His tagDepositorInsertmCherry
ExpressionBacterialPromoteryibDpAvailable sinceMay 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDonor14-AcHELIX-KanR (CJT96)
Plasmid#181794PurposepDonor for AcHELIX containing 14bp of spacing between the I-AniI site and LE/RE using ShCAST flanking sequence and encoding a kanamycin resistance gene as cargoDepositorInsertKanR, R6K origin of replication
ExpressionBacterialAvailable sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-kanMX6-P41nmt-3HA
Plasmid#39284DepositorPublicationInsertnmt1 promoter (nmt1 Fission Yeast)
UseYeast genomic targetingTags3xHA, A. gossypii translation elongation factor 1…Mutation-1163 to +6 of nmt1 locus with a 4bp deletion (TA…Available sinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMST636_BB3_L_AD_hyg_KanOri_pyrG5
Plasmid#90281PurposeBB3 recipient for homologous integration in pyrG locus with linker ADDepositorTypeEmpty backboneExpressionBacterialAvailable sinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
GPKAnes
Plasmid#61092PurposeGFP-tagged PKA catalytic subunit targeted to the extranuclear cytoplasm by addition of a nuclear export signalDepositorPublicationInsertpkac2
TagsEGFPExpressionMammalianPromoterCMVAvailable sinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUC57KAN-80XALFA
Plasmid#233124Purpose80X ALFA tag multimerDepositorInsertALFA tag
UseUnspecifiedMutationNoneAvailable sinceMarch 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC57KAN-20XALFA
Plasmid#233112Purpose20X ALFA tag multimerDepositorInsertALFA tag
UseUnspecifiedMutationNoneAvailable sinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKanB alpha
Plasmid#223524PurposeUsed for expression of secreted recombinant protein in Pichia pastoris; with G418 resistance gene as selectable markerDepositorTypeEmpty backboneExpressionYeastPromoterAOX1Available sinceSept. 11, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pgRNAkan-glpR
Plasmid#169873PurposeSingle guide RNA plasmid for Cas9 targeting glpR in P. putidaDepositorInsertsgRNA towards glpR in Pseudomonas putida
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable sinceJuly 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
RS02060_pMQ30_KO_Kan
Plasmid#185391PurposeNon-replicating vector used to create markerless deletion of RR42_RS02060 in C. basilensis 4G11DepositorInsertsRR42_RS02060 upstream flanking homology region
RR42_RS02060 downstream flanking homology region
Available sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
RS28935_pMQ30_KO_Kan
Plasmid#185392PurposeNon-replicating vector used to create markerless deletion of RR42_RS28935 in C. basilensis 4G11DepositorInsertsRR42_RS28935 upstream flanking homology region
RR42_RS28935 downstream flanking homology region
Available sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
RS18965_pMQ30_KO_Kan
Plasmid#185394PurposeNon-replicating vector used to create markerless deletion of RR42_RS18965 in C. basilensis 4G11DepositorInsertsRR42_RS18965 upstream flanking homology region
RR42_RS18965 downstream flanking homology region
Available sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
RS18970_pMQ30_KO_Kan
Plasmid#185395PurposeNon-replicating vector used to create markerless deletion of RR42_RS18970 in C. basilensis 4G11DepositorInsertsRR42_RS18970 upstream flanking homology region
RR42_RS18970 downstream flanking homology region
Available sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
RS17060_pMQ30_KO_Kan
Plasmid#185396PurposeNon-replicating vector used to create markerless deletion of RR42_RS17060 in C. basilensis 4G11DepositorInsertsRR42_RS17060 upstream flanking homology region
RR42_RS17060 downstream flanking homology region
Available sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
RS17055_pMQ30_KO_Kan
Plasmid#185398PurposeNon-replicating vector used to create markerless deletion of RR42_RS17055 in C. basilensis 4G11DepositorInsertsRR42_RS17055 upstream flanking homology region
RR42_RS17055 downstream flanking homology region
Available sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDZ645 pKAN 1x-mCherry-12xPP7 V4
Plasmid#73173PurposeFloxed Kanamycin (G418) selection maker; 3' tagging vector used to add 1x-mCherry followed by 12 repetitive PP7 version 4 RNA stem-loops to gene of interestDepositorInsert1x-mCherry
ExpressionMammalian and YeastAvailable sinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHCKan-yibDp2-GFPuv
Plasmid#139083PurposeLow phosphate inducible promoter yibDp2 for GFP expressionDepositorInsertyibDp2-GFPuv
ExpressionBacterialAvailable sinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKD4_mCherry
Plasmid#187386PurposeTo chromosomally tag genes of interest with mCherry. FRT-mCherry-kan-FRTDepositorInsertmCherry
ExpressionBacterialAvailable sinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC-H1-Esp3I-mU6-Kan
Plasmid#213015PurposeVector for Cloning of multiple gRNAs driven by distinct promoters (H1 and mU6)DepositorInsertH1 promoter, mU6 promoter, gRNA scaffolds
PromoterH1 promoterAvailable sinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only