We narrowed to 6,269 results for: pAAV
-
Plasmid#59968PurposeAn AAV packaging vector that expresses catalytically-inactive hPREP under control of the EF1a promoter.DepositorAvailable SinceOct. 8, 2014AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-CAG-SuperNovaGreen-T2A-dTomato
Plasmid#193798PurposeExpresses SuperNova Green in the cytosol of mammalian cells, joined by a T2A cleavage site with dTomatoDepositorInsertSuperNova Green
UseAAVTagsFlag tagExpressionMammalianPromoterCAGAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DO-ChETA-TdTomato-WPRE-pA
Plasmid#37756PurposeExpresses ChETA-TdTomato in cells lacking Cre (Cre-Off), for optogenetic excitationDepositorInsertChETA-TdTomato
UseAAV and Cre/Lox; Cre-offTagsTdTomatoPromoterEF1aAvailable SinceJuly 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-FRT-JEDI-1P-Kv-WPRE
Plasmid#202617PurposeGenetically encoded voltage indicator (GEVI) JEDI-1P flanked by FRT in AAV production vector expressed under the mammalian promoter (EF1a), FLP recombinase-dependentDepositorInsertFRT-JEDI-1P-Kv
UseAAV; Flp/frtExpressionMammalianPromoterEF1aAvailable SinceJune 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
151_pAAV-ProC29-CatCh-GFP-WPRE
Plasmid#125964PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC29Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-SnFR-gamma8-minWPRE
Plasmid#165498PurposeAAV for glutamate reporter fused to TARP gamma-8DepositorInsertiGluSnFR extracellular domain fused to TARP gamma-8 via NETO2 TM domain (Cacng8 Synthetic, Rat)
UseAAVPromoterhSynapsinAvailable SinceMarch 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
III_pAAV-ProB4-CatCh-GFP-WPRE
Plasmid#125924PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB4Available SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-ConVERGD-eGFP-WPRE
Plasmid#218747PurposeProvides AND intersectional (Cre+Flp) expression of eGFPDepositorInserteGFP
UseAAVPromoternEFAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-ConVERGD-eGFP-W3SL
Plasmid#218746PurposeProvides AND intersectional (Cre+Flp) expression of eGFPDepositorInserteGFP
UseAAVPromoternEFAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-GRAB_r5-HT1.0
Plasmid#208725PurposeExpresses the red 5-HT sensor GRAB_r5-HT1.0 in neurons in the presence of Cre recombinaseDepositorInsertRed fluorescent 5-HT sensor GRAB_r5-HT1.0
UseAAVPromoterEF1aAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-rsChRmine-eYFP-WPRE
Plasmid#183531PurposeOptogeneticsDepositorInsertrsChRmine-eYFP
UseAAVMutationI146M/G174SPromoterCaMKIIaAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FDIO-IGK-dAPEX2-KDEL
Plasmid#117184PurposePlasmid name in publication: pAAV-FDIO-ER-dAPEX2. Peroxidase reporter for multiplexed electron microscopy labelingDepositorInsertIGK-dAPEX2-KDEL
UseAAV; Flp/frtExpressionMammalianMutationW41F and A134P on soybean APXPromoterEF1aAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-TVA66T-EGFP
Plasmid#64091PurposeExpresses TVA66T-EGFP under the CAG promotorDepositorInsertTVA66T-EGFP
UseAAV and Cre/LoxTagsEGFPExpressionMammalianMutationGlutamic acid 66 to ThreoninePromoterCAGAvailable SinceApril 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DIO-mDLX-TVA-2A-N2cG
Plasmid#172365PurposeTargeting envA-pseodotyped RVdG-CVS-N2c vectors for specific retrograde labeling from cre-expressing inhibitory neuronsDepositorInsertTVA + B19-N2cG
UseAAV and Cre/LoxExpressionMammalianPromotermDLXAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(OXTR.1)-CMV-eGFP
Plasmid#194015PurposeExpresses a gRNA that targets OXTR coding sequence in multiple (rodent) species and eGFPDepositorInsertssgRNA(Oxtr.1)
eGFP
UseAAV and CRISPRExpressionMammalianPromoterCMV and u6Available SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
17_pAAV-ProB1-CatCh-GFP-WPRE
Plasmid#125921PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB1Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
107_pAAV-ProC17-CatCh-GFP-WPRE
Plasmid#125952PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC17Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
12_pAAV-ProC2-CatCh-GFP-WPRE
Plasmid#125938PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC2Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DO-ChETA-EYFP-WPRE-pA
Plasmid#37086PurposeExpresses ChETA-EYFP in cells lacking Cre (Cre-Off), for optogenetic excitationDepositorInsertChETA-YFP
UseAAV and Cre/Lox; Cre-offTagsEYFPPromoterEF1aAvailable SinceJuly 27, 2012AvailabilityAcademic Institutions and Nonprofits only