We narrowed to 5,751 results for: aaas
-
Plasmid#75657Purpose3rd generation lentiviral gRNA plasmid targeting human WNK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
SRPK2 gRNA (BRDN0001145583)
Plasmid#75600Purpose3rd generation lentiviral gRNA plasmid targeting human SRPK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NEK11 gRNA (BRDN0001144720)
Plasmid#75560Purpose3rd generation lentiviral gRNA plasmid targeting human NEK11DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NLK gRNA (BRDN0001146865)
Plasmid#75481Purpose3rd generation lentiviral gRNA plasmid targeting human NLKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
UCK1 gRNA (BRDN0001148467)
Plasmid#77419Purpose3rd generation lentiviral gRNA plasmid targeting human UCK1DepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSicoR (EGFP) shPnky-2
Plasmid#79142PurposeStable expression of shRNA targeting mouse Pnky. The shRNA (and EGFP) can be excised by the addition of CreDepositorInsertshPnky-2 (Gm30731 Mouse)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6 for the shRNA and CMV for EGFPAvailable SinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
OXSR1 gRNA (BRDN0001149240)
Plasmid#77749Purpose3rd generation lentiviral gRNA plasmid targeting human OXSR1DepositorAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
3692 pGEX4T-3 MLL AD mut.B
Plasmid#8864DepositorInsertMLL min A.D. (KMT2A Human)
TagsGSTExpressionBacterialMutationILPSDIMDFVL --> ILPSAAAAFVLAvailable SinceAug. 3, 2005AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-3'UTR
Plasmid#136038PurposeG3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2 hBAX
Plasmid#129580PurposeCRISPR deletion of human BAXDepositorAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
9X NFAT-apha-MHC-Luc
Plasmid#51941Purpose9 copies of NFAT sites in minimal alphaMHC-pGL-3DepositorInserts9x NFAT binding site
alpha-MHC
UseLuciferaseTagsluciferaseAvailable SinceMay 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLentiX2-PURO-shLKB1-Hu
Plasmid#61242PurposeLentivirus expressing shRNA to human LKB1DepositorInsertLKB1 (STK11 Human)
UseLentiviralAvailable SinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_UCA1
Plasmid#72628PurposeExpresses two gRNAs targeting the UCA1 promoterDepositorInsertgRNAs toward UCA1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_Malat1_C
Plasmid#72622PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
p8103 LentiCRISPR v2 sgNT-2
Plasmid#163313PurposeExpresses Cas9 and a non-targeting control guide RNADepositorInsertsgNT-2
UseCRISPR and LentiviralPromoterU6Available SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR-TER+-shLKB1-Hu
Plasmid#61243PurposeEntry clone encoding shRNA to human LKB1DepositorAvailable SinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO-STAG2 shRNA 1221
Plasmid#31978DepositorAvailable SinceAug. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
px330-UFM1 sgRNA2
Plasmid#134634Purposecontains sgRNA targeting human UFM1 for gene knockoutDepositorInsertUFM1 sgRNA2 (UFM1 Human)
ExpressionMammalianAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-CAPRIN1-3'UTR
Plasmid#136055PurposeCAPRIN1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCACGTTAGTGTCACAAATT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only