We narrowed to 6,269 results for: pAAV
-
Plasmid#125974PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC40Available SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1 ObLiGaRe Donor vector/EPB58
Plasmid#90016PurposeDonor vector for ObLiGaRe/ZFN mediated targeting to AAVS1 locusDepositorInsertMCS flanked by inverted ZFN binding sites (PPP1R12C Human)
ExpressionBacterialAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Flex-Rev-TdTomato
Plasmid#122501PurposeCre-dependent TdTomato expression.DepositorInsertTdTomato
UseAAVPromoterCAGAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS5-TVA-eGFP-N2cG
Plasmid#175440PurposeCre-on / Flp-off helpers for N2c rabies monosynaptic tracing; TVA, eGFP and N2cG under Synpasin promotoerDepositorInsertTVA-P2A-eGFP-P2A-N2cG
UseAAV and Cre/LoxAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
88_pAAV-ProA5-CatCh-GFP-WPRE
Plasmid#125889PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA5Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn_NLS-His-rsCaMPARI-mRuby3
Plasmid#122092PurposeAAV plasmid for expressing rsCaMPARI in neurons, nucleus localizedDepositorInsertrsCaMPARI
UseAAVTagsNLS-His and mRuby3Promoterhsyn (synapsin-1)Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-splitTVA-EGFP
Plasmid#59332PurposeExpresses splitTVA-P2A-EGFPDepositorInsertsplitTVA950-P2A-EGFP
UseAAV and Cre/LoxTagsGFPExpressionMammalianPromoterCAGAvailable SinceSept. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex-Turbo/GFP
Plasmid#197886PurposeCan be used to generate AAV virus that will express Turbo/GFP in the presence of CreDepositorInsertTurbo/GFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEXfrt-SaCas9-U6-sgNtsr1
Plasmid#159910PurposeMutagenesis of Ntsr1DepositorInsertNtsr1 (Ntsr1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-CCre-MBP1-WPRE
Plasmid#193917PurposeExpresses one of the components of Cre-DOR_N6C1 (RFP-dependent Cre)DepositorInsertCCre-MBP1
UseAAV, Affinity Reagent/ Antibody, Cre/Lox, and Syn…ExpressionMammalianPromoterEF1aAvailable SinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-NCre-MBP6-WPRE
Plasmid#193916PurposeExpresses one of the components of Cre-DOR_N6C1 (RFP-dependent Cre)DepositorInsertNCre-MBP6
UseAAV, Affinity Reagent/ Antibody, Cre/Lox, and Syn…ExpressionMammalianPromoterEF1aAvailable SinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV syn CCL20-pre-mGRASP
Plasmid#173117PurposeExpresses CCL20 sender construct in neuronsDepositorInsertCCL20-pre-mGRASP
UseAAVPromoterSynapsinAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
78_pAAV-ProA27-CatCh-GFP-WPRE
Plasmid#125910PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA27Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-jGCaMP7c variant 1513
Plasmid#173159PurposeExpresses jGCaMP7c variant 1513 in astrocytesDepositorInsertjGCaMP7c variant 1513-WPRE
UseAAVPromoterGFAPAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
45_pAAV-ProC10-CatCh-GFP-WPRE
Plasmid#125945PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC10Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pgk-DIO-rvCRY-WPRE
Plasmid#182060PurposePlasmids for production of AAV-based TFactivity reporterDepositorInsertmCherry
UseAAVPromoterhu Pgk1Available SinceMarch 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-TBG-FLAG-mRIPK1-S321A
Plasmid#115342PurposeLiver-specific adeno-associated viral delivery and mammalian expression of Flag-mRIPK1-S321ADepositorAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only