We narrowed to 8,957 results for: aav
-
Plasmid#220661PurposeAiE2367m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP1530 - pAAV-AiE2115m_3xC2-minBG-SYFP2-WPRE-BGHpA
Plasmid#220657PurposeAiE2115m_3xC2 is an optimized enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-driven AcrIIC3-scaffold (2xBsmBI sites)
Plasmid#120301PurposeAAV vector for expression of AcrIIC3 (no miR binding sites, control vector)DepositorInsertAcrIIC3
UseAAV and CRISPRExpressionMammalianAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6m-WPRE-pA
Plasmid#51473PurposeBicistronic vector expressing mRuby2 and GCaMP6m from a single open reading frame.DepositorInsertmRuby2-P2A-GCaMP6m
UseAAVPromoterhSyn1Available SinceApril 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-SpCas9_gRNA(RHO-P23H)-CMV-mTagBFP2_(RAS3613)
Plasmid#228252PurposepU6 (human U6) expression of SpCas9 sgRNA targeting RHO P23H mutation and pCMV expression of mTagBFP2DepositorInsertSpCas9 P23H sgRNA, mTagBFP2
ExpressionMammalianMutationn/aPromoterCMV and U6Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP995-pAAV-mscRE10-minBGpromoter-EGFP-WPRE-hGHpA
Plasmid#163485PurposeDirect-expressing EGFP AAV Virus. Alias: AiP995 - pAAV-AiE2010m-minBG-EGFP-WPRE-HGHpADepositorInsertEGFP
UseAAVPromoterBeta Globin minimal promoterAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
AiP1365 - pAAV-AiE2136m-minBG-SYFP2-WPRE3-BGHpA
Plasmid#230630PurposeAiE2136m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP1376 - pAAV-AiE2147m-minBG-SYFP2-WPRE-BGHpA
Plasmid#220645PurposeAiE2147m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP1962 - pAAV-AiE2591m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214592PurposeAiE2591m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1425 - pAAV-AiE2132m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214495PurposeAiE2132m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1774 - pAAV-AiE2449m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214540PurposeAiE2449m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-DIO-GtACR2-P2A-Voltron2ST-W3SL
Plasmid#217676PurposeAAV-mediated, Cre-dependent co-expression of GtACR2 and soma-targeted Voltron2 (ORCHID) for assessing inhibitory receptor driving force through voltage imaging with concurrent activation of GtACR2.DepositorHas ServiceAAV1InsertGtACR2-P2A-Voltron2ST
UseAAVTagsSoma targeting sequence (Kv2.1) on Voltron2 gene …ExpressionMammalianPromoterEF‐1αAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
p226-AAV-dlx-dio-mScarlet-T2A-SYPEGFP
Plasmid#185696PurposeAAV vector expressing cre-dependent mem-mScarlet, T2A, Synaptophysin-EGFP driven by Dlx promoterDepositorInsertmScarlet, T2A, Synaptophysin-EGFP
UseAAV and Cre/LoxTagsmScarlet palmitoylation, Synaptophysin fused to E…ExpressionMammalianPromotermDlxAvailable SinceJuly 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
AiP14924 - pAAV-AiE0675m-minBG-iCre(297T)-BGHpA
Plasmid#233571PurposeAiE0675m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertiCre(R297T)
UseAAVAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC468 - pAAV EF1a DIO hChR2(H134R)-iRFP
Plasmid#47633PurposeAn AAV vector that expresses channel rhodopsin 2 (H134R) (fused to iRFP) in a Cre-dependent manner (DIO, double floxed inverted open reading frame).DepositorInserthChR2 (H134R)
UseAAV and Cre/LoxTagsiRFPExpressionMammalianMutationH134RPromoterEF1aAvailable SinceSept. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-jGCamp7b-P2A-GSG-mRuby3
Plasmid#130900Purposebicistronic plasmid for dual-color neuronal calcium and morphology imagingDepositorInsertjGCaMP7b-P2A-mRuby3
UseAAVExpressionMammalianPromoterhSynAvailable SinceSept. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Foff 2.0-NpHR3.3-EYFP
Plasmid#137153PurposeIntersectional viral expression of NpHR3.3-EYFP in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-NpHR3.3-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationW179FPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-AIO-M11-gRNA-EFS-NMS-SadCas9
Plasmid#210710PurposeThis Plasmid express M11 promoter driven SadCas9 specific gRNA and EFS promoter driven NMS transactivation module fused to SadCas9DepositorInsertSadCas9 specific gRNA and NMS fused to N-terminus of SadCas9
UseAAV and CRISPRTagsFLAGExpressionMammalianMutationD10A/N580APromoterM11Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
AiP1733 - pAAV-AiE2389m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214532PurposeAiE2389m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Foff 2.0-Arch3.3-EYFP
Plasmid#137149PurposeIntersectional viral expression of Arch3.3-EYFP in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-Arch3.3-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationn/aPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Camk2a(0.4)-DIO-Opto-cytTrkB(E281A)-HA
Plasmid#180588PurposeOpto-cytTrkBDepositorInsertTrkB
UseAAVMutationPHR(E281A)Available SinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-FlpOn-CreOff-MCS-P2A-mCherry
Plasmid#176277PurposeViral vector for co-expression of a CDS of interest and mCherry in cells expressing Flp AND NOT Cre driven by a Synapsin promoter. Contains an in-frame P2A sequence and an MCS for cloning of the CDS.DepositorInsertMCS-P2A-mCherry
UseAAV and Cre/LoxExpressionMammalianPromoterhuman Synapsin IAvailable SinceDec. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
AiP1894 - pAAV-AiE2582m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214573PurposeAiE2582m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1731 - pAAV-AiE2386m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214531PurposeAiE2386m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
rAAV-syn::FLEX-rev::PSAML141F:GlyR-IRES-GFP
Plasmid#32479PurposeCre-dependent expression of PSAM-GlyR (L141F) neuronal inhibitor, with IRES-EGFP markerDepositorInsertPSAML141F-GlyR-IRES-GFP
UseAAV and Cre/Lox; Adeno-associated virus, flex swi…TagsIRES-EGFPPromoterSynapsinAvailable SinceJan. 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
AiP1492 - pAAV-AiE2004m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214501PurposeAiE2004m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1332 - pAAV-AiE2114m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214483PurposeAiE2114m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP2107 - pAAV-AiE2664m-minBG-SYFP2-WPRE3-BGHpA
Plasmid#230553PurposeAiE2664m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ADAR2-2a-Fezf2 sesRNA-2a-tTA2-WPRE
Plasmid#239027PurposeExpression of ADAR2, sesRNA in mammalian cells with hSyn promoter, with tTA2 as efRNA and ADAR2 overexpression.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP1788 - pAAV-AiE2116m-minBG-iCre(R297T)-BGHpA
Plasmid#220713PurposeAiE2116m is an enhancer sequence, designed to induce cre-dependent recombination in specific populations of brain cellsDepositorInsertiCre(R297T)
UseAAVPromoterminBGAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
LZF1826 pAAV_hSyn-DiO-SomArchon-EGFP-P2A-stGtACR2
Plasmid#135412Purposesimultaneous optical recording and manipulation of electrical activity in neuronsDepositorInsertSomArchon-EGFP-P2A-stGtACR2
UseAAVExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
AiP1848 - pAAV-AiE2435m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214552PurposeAiE2435m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1048-pAAV-mscRE10-minBGpromoter-tTA2-WPRE-hGHpA
Plasmid#163481PurposeDirect-expressing tTA2 AAV Virus. Alias: AiP1048 - pAAV-AiE2010m-minBG-tTA2-WPRE-HGHpADepositorInserttTA2
UseAAVPromoterBeta Globin minimal promoterAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn ChR E90R-D156N-T159C 2A tDimer
Plasmid#52494PurposeHistorical plasmid. For inhibition of neuronal activity, note that Addgene Plasmid #66709 is a light-gated chloride channel with improved anion selectivity (iChloC)DepositorInsertsChannelrhodopsin-2
red fluorescent protein
UseAAVExpressionMammalianMutationE90R, D156N, T159CPromoterhuman synapsin-1 and ribosomal skip sequenceAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-ChroME-ST-P2A-H2B-mRuby3
Plasmid#170161PurposeCation channelrhodopsin ChroME targeted to the neuronal soma and proximal dendrites and separated from nuclear mRuby3 by P2A in a viral vectorDepositorInsertChroME-P2A-H2B-mRuby3
UseAAVExpressionMammalianAvailable SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-CAG-flex-iGABASnFR2(no bind)-WPRE
Plasmid#218882PurposeAAV-mediated expression of improved GABA sensor control (no change in fluorescence)DepositorInsertiGABASnFR2(no bind)
UseAAV and Cre/LoxExpressionMammalianMutationS99A F102G R168PPromoterCAGAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP2017 - pAAV-AiE0774m-minBG-iCre(R297T)-BGHpA
Plasmid#220723PurposeAiE0774m is an enhancer sequence, designed to induce cre-dependent recombination in specific populations of brain cellsDepositorInsertiCre(R297T)
UseAAVPromoterminBGAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP1287 - pAAV-AiE2103m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214480PurposeAiE2103m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1971 - pAAV-AiE2587m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214599PurposeAiE2587m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only