We narrowed to 173,477 results for: addgene
-
Plasmid#207284PurposeMammalian expression of Junin virus GPC proteinDepositorInsertJUNV_GPC
ExpressionMammalianMutationmammalian codon optimizationPromoterCMV promoterAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-TagBFP-2A-BSD
Plasmid#167929PurposeLentiviral gRNA expression with TagBFP fluorescence and blasticidin selection marker.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6, EF1aAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBiFC-bFosVC155
Plasmid#22013DepositorInsertbFosVC155
TagsHAExpressionMammalianMutationN/AAvailable SinceOct. 6, 2009AvailabilityAcademic Institutions and Nonprofits only -
HA-Clover-HIF-1alpha Wildtype
Plasmid#163365PurposeExpress HA- and Clover-tagged HIF-1alpha wildtype plasmidDepositorInsertHypoxia Inducible Factor 1 alpha (HIF1A Human)
TagsHA- and Clover-taggedExpressionMammalianMutationWildtypePromoterCMV PromoterAvailable SinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GfaABC1D-GRAB_Ado1.0
Plasmid#153288PurposeExpress the adenosine sensor GRAB_Ado1.0 in astrocytesDepositorInsertAdenosine sensor GRAB_Ado1.0
UseAAVPromoterGfaABC1DAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHACK-GAL4>QF2(newHA1)
Plasmid#104873PurposeHACK Donor plasmids for converting GAL4 lines to QF2 lines using HACK method. Updated version of Addgene#80275 for easier cloning of insertsDepositorInsertT2A-QF2
UseCRISPRExpressionInsectAvailable SinceMarch 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHPRT-DRGFP
Plasmid#26476PurposeDR-GFP substrate (Addgene 26475) flanked by mouse hprt targeting sequencesDepositorInsertpHPRT-DRGFP
UseMouse TargetingExpressionMammalianAvailable SinceNov. 3, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCrlM
Plasmid#122444PurposeExpresses myc tagged mouse reelin ORF in mammalian cellsDepositorAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVCT-tTR-KRAB
Plasmid#11643PurposeTet-regulated (Tet-on) lentiviral vector for transgene (CAG promoter) - OR - shRNA (H1 promoter when subcloned from pLVTHM (Addgene#12247)) - 2nd generationDepositorInsertCAG promoters, GFP, tTR-KRAB, Tet-on
UseLentiviralExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLV-EGFP-Human-UTROPHIN_1-261
Plasmid#222393PurposeExpress in mammalian cells the EGFP fused to residues 1-261 of Human Utrophin to detect filamentous actin in live, fix cels or tissues.DepositorInsertHuman Utrophin residues 1-261 and EGFP (UTRN Human, Homo Sapiens)
UseLentiviralTagsEGFP and Human UTROPHIN 1-261ExpressionMammalianMutationSequence is derived from ADDGENE Plasmid #26737-G…PromoterCMV promoter and enhancerAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pICH47732:FCP:NAT
Plasmid#85984PurposeGolden Gate Level 1 cassette encoding a Nat selectable marker under the FCP promoterDepositorInsertNAT
UseGolden gate assemblyPromoterFCPAvailable SinceMarch 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-multi-v2-SpCas9-P2A-Puro-BsmBI_entry (pRW1512)
Plasmid#225756PurposeEntry vector to clone sgRNA(s) into the CROPseq-multi-v2 construct with expression of SpCas9 and Puromycin resistance; v2 is compatible with T7 in vitro transcription detectionDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-shNT
Plasmid#109012Purposeshort-hairpin knockdown of targeted geneDepositorInsertNon-targeting shRNA
UseLentiviralExpressionMammalianPromoterhU6 promoterAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLB
Plasmid#11619PurposepLB is a modification of pLL3.7 (Addgene#11795). Genetic elements known to prevent epigenetic silencing were added.DepositorTypeEmpty backboneUseCre/Lox, Lentiviral, and RNAiTagsGFPExpressionMammalianPromotermouse U6Available SinceJuly 19, 2006AvailabilityAcademic Institutions and Nonprofits only -
SoxS-GFP
Plasmid#220165PurposeTo track the natural SoxS promoter's transcriptional dynamicsDepositorInsertSoxS promoter only
ExpressionBacterialAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRBad-Z-CspGFP
Plasmid#40730DepositorInsertLeucine Zipper prime - C super positive Green Fluorescent Protein
ExpressionBacterialPromoterpBadAvailable SinceNov. 26, 2012AvailabilityAcademic Institutions and Nonprofits only -
pET11a-Z-NspGFP
Plasmid#40729DepositorInsertN super positive GFP - Leucine Zipper
TagsHisExpressionBacterialPromoterT7Available SinceNov. 26, 2012AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-BC-start
Plasmid#127168PurposeEntry plasmid for two-step guide-barcode cloningDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterN/AAvailable SinceJune 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
miReporter-CAG
Plasmid#82478PurposemicroRNA reporter relying on a bidirectional CAG-based promoter. Contains MCS downstream of H2B-mCherry and H2B-Citrine to insert miRNA binding sites. Contains a Hygromycin selection cassette.DepositorInsertH2B-mCherry and H2B-Citrine. HygroR
Available SinceFeb. 14, 2017AvailabilityAcademic Institutions and Nonprofits only