We narrowed to 292 results for: h cas9 protein
-
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
NLS-HA-2xMCP-Ezh2
Plasmid#126590PurposeExpresses MCP (MS2 Coat Protein) fusion to Ezh2 in mammalian cells, lentiviral backboneDepositorInsert2XMCP-Ezh2 (Ezh2 Synthetic, Mouse)
UseLentiviralTagsNLS-HAExpressionMammalianPromoterhuman ubiquitin C promoterAvailable SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAN1646
Plasmid#127205PurposepTet expression of Venus, Dual inducible expression of dCas9-VP64-mScarlet-degronSwitchA and KeyA-BFP-NLSDepositorInsertp7x_tet-Venus-tADH1-pGal1-dCas9-VP64-Linker-mScarlet-Linker-degronSwitch_A_t12-tPGK1-pZ3-key_A_e18-mTagBFP2-NLS(SV40)-tSSA1
UseSynthetic BiologyAvailabilityAcademic Institutions and Nonprofits only -
PX458_RXRB_1
Plasmid#104050PurposeEncodes gRNA for 3' target of human RXRB along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_RXRB_2
Plasmid#104051PurposeEncodes gRNA for 3' target of human RXRB along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE7
Plasmid#214812PurposeMammalian expression of SpCas9 PE7 prime editorDepositorInsertPE7
TagsSV40 bpNLS and c-Myc NLSExpressionMammalianPromoterCMVAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEPOR2KN0041
Plasmid#117608PurposeLevel2 MoClo construct, containing level1 plant expression cassettes for SpCas9-h(pICSL11023) and sgRNA_RPS4A family protein {AT5G58420 }(pEPOR1CB0071)DepositorInsert[35S:SpCas9-h(pICSL11023) ] +[AtU6-26:sgRNA]
ExpressionPlantAvailable SinceNov. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B1
Plasmid#172842PurposeCRISPIE donor B1 (Zhong et al, eLife 2021), mEGFP translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mEGFP
UseCRISPRAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B2
Plasmid#172843PurposeCRISPIE donor B2 (Zhong et al, eLife 2021), mRuby3 translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 or DRS-2 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mRuby3
UseCRISPRAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B3
Plasmid#172844PurposeCRISPIE donor B3 (Zhong et al, eLife 2021), mTurquoise2 translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mTurquoise2
UseCRISPRAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B4
Plasmid#172845PurposeCRISPIE donor B4 (Zhong et al, eLife 2021), mNeonGreen translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mNeonGreen
UseCRISPRAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHS1625
Plasmid#239834PurposeOrufIscB-REC E. coli expression for recombinant purificationDepositorInsertOrufIscB-REC
Tags14xHis-TwinStrep-bdSUMOExpressionBacterialMutationInsertion of REC domain from NbaCas9-1PromoterT7Available SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS1505
Plasmid#239830PurposeOrufIscB-REC mammalian expressionDepositorInsertOrufIscB-REC
TagsNucleoplasmin NLS-3xHA and SV40 NLSExpressionMammalianMutationInsertion of REC domain from NbaCas9-1PromoterCMVAvailable SinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS_Nova
Plasmid#239831PurposeNovaIscB mammalian expressionDepositorInsertNovaIscB
TagsNucleoplasmin NLS-3xHA and SV40 NLSExpressionMammalianMutationInsertion of REC domain from NbaCas9-1 and swap o…PromoterCMVAvailable SinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS1742
Plasmid#239838PurposeOrufIscB-KRK mammalian expressionDepositorInsertOrufIscB-KRK
TagsNucleoplasmin NLS-3xHA and SV40 NLSExpressionMammalianMutationInsertion of REC domain from NbaCas9-1 + E137K/E4…PromoterCMVAvailable SinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS1993
Plasmid#239836PurposeOMEGAOff-KRK mammalian expressionDepositorInsertDNMT3A-DNMT3L-OrufIscB-KRK-KRAB
TagsHA and SV40 NLSExpressionMammalianMutationInsertion of REC domain from NbaCas9-1 + E137K/E4…PromoterCMVAvailable SinceJuly 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS2096
Plasmid#239835PurposeNovaIscB E. coli expression for recombinant purificationDepositorInsertNovaIscB
Tags14xHis-TwinStrep-bdSUMOExpressionBacterialMutationInsertion of REC domain from NbaCas9-1 and swap o…PromoterT7Available SinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B5
Plasmid#172846PurposeCRISPIE donor B5 (Zhong et al, eLife 2021), CDS of VCL exon21-mEGFP, translational phase (0-stop), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-stop) encoding the CDS of VCL exon 21 fused to mEGFP
UseCRISPRAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330 _CRISPIE donor B8
Plasmid#172849PurposeDRS-2 sgRNA expression under a U6 promotor and CRISPIE donor B8 (Zhong et al, eLife 2021), mEGFP translational phase (1-1), excised by DRS-1 or DRS-2 sgRNA (with SpCas9).DepositorInsertDRS-2 sgRNA and CRISPIE designer exon (phase 1-1) encoding mEGFP
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330 _CRISPIE donor B7
Plasmid#172848PurposeDRS-2 sgRNA expression under a U6 promotor and CRISPIE donor B7 (Zhong et al, eLife 2021), mEGFP translational phase (0-0), excised by DRS-1 or DRS-2 sgRNA (with SpCas9).DepositorInsertDRS-2 sgRNA and CRISPIE designer exon (phase 0-0) encoding mEGFP
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only