We narrowed to 14,709 results for: ung
-
Plasmid#106417PurposeExpress Complexin-1 fragment (1-83) in E. coliDepositorInsertcomplexin-1 fragment 1-83 (Cplx1 Synthetic, Rat)
TagsGST tagExpressionBacterialMutationFragment 1-83, Codon optimizationPromoterT7Available SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNIC28-Bsa4-ICL1
Plasmid#105822PurposeExpression of Mycobacterium tuberculosis icl1 recombinant proteinDepositorInserticl1
TagsHis tag with TEV cleavageExpressionBacterialPromoterT7Available SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDBEcR/Bla
Plasmid#201556PurposePlasmid with SB ITRs for expressing DBEcR (3xmyc-tagged) under EF1α promoter; blasticidin resistance.DepositorInsertDBEcR
UseUnspecified; Sleeping beauty transposonTagsMycExpressionMammalianPromoterEF1aAvailable SinceJuly 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSUPER.retro-{beta}4 SCR
Plasmid#16267DepositorAvailable SinceMarch 6, 2008AvailabilityAcademic Institutions and Nonprofits only -
pRVdG-4RFP
Plasmid#52489PurposeExpresses TagRFP-TDepositorInsertTagRFP-T
UseRabies virusPromoterCMVAvailable SinceAug. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV-CB1R-V2tail-TevN-BLITz1-TetR-VP16
Plasmid#89872Purposeexpresses CB1R-iTango component in mammalian cellsDepositorInsertCB1R-V2tail-TevN-BLITz1-TetR-VP16
ExpressionMammalianPromoterCMVAvailable SinceMay 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJBL704
Plasmid#140374PurposeExpresses TetR-regulated 3WJdB RNA aptamer driven by T7 promoter with the tetO sequence 4BP dowsntream from the promoterDepositorInsertT7-4BP-tetO-3WJdB-T
UseSynthetic BiologyAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBL705
Plasmid#140375PurposeExpresses TetR-regulated 3WJdB RNA aptamer driven by T7 promoter with the tetO sequence 5BP dowsntream from the promoterDepositorInsertT7-5BP-tetO-3WJdB-T
UseSynthetic BiologyAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
Desmin/pAS2-1
Plasmid#97407PurposeDesmin (aa 30 – 103) in DNA-binding domain (BD) vector, used for yeast-two hybridDepositorInsertDesmin (DES Human)
ExpressionYeastAvailable SinceAug. 21, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T MDM2 S186D
Plasmid#16239DepositorAvailable SinceNov. 30, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-SERTS585P-myc
Plasmid#107498PurposeMammalian expression plasmid for codon optimized mutant hSERT with internal MYC tag inserted in ECL2, mutation S585P conferring gain of function phenotypeDepositorAvailable SinceMarch 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T MDM2 S166D
Plasmid#16238DepositorAvailable SinceNov. 30, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-SERTG56A -myc
Plasmid#107459PurposeMammalian expression plasmid for codon optimized mutant hSERT with internal MYC tag inserted in ECL2, mutation G56A conferring wildtype phenotypeDepositorAvailable SinceMarch 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-REG1-CDS
Plasmid#136053PurposeREG1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (TATGGGATCAAGTGCCGATTC)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRI007-pGEM-PgpdA-Cas12aScaffold-BsmbI-TtrpC
Plasmid#140200PurposeCloning vector for LbCas12a crRNAs ( Step 1 of the 2-step cloning alternative). Full PgpdA sequence is reconstituted when amplifying the expression cassette for cloning in a fungal vector.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyTagsdLbCas12a crRNA scaffoldPromoterPgpdAAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFGL1170R
Plasmid#116896PurposehH1:mCherry (nuclear marker)DepositorInsertshH1
mCherry
hH1 downstream region
UseFungal expression (in magnaporthe oryzae)Mutationno start codon, no stop codon and without start c…Promoterpromoter lessAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHL 651
Plasmid#53016PurposeLacIq + PCon::RBS (st3) tetR::T1 terminator + p15a + CamR. Backbone from pZA32MCS1 (Lutz and Bujard, 1997).DepositorInsertsLacIq
tetR
UseSynthetic BiologyTagsRBS(st3) and T1 terminatorExpressionBacterialPromoterpConAvailable SinceMay 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHL 1277
Plasmid#53017PurposeAmpR + PLtetO-1::RBS (st7) gfp::T1 terminator + PLlacO-1::RBS (st7) mCherry::Asp terminator + ColE1DepositorInsertsGFP
mCherry
UseSynthetic BiologyTagsRBS(st7)ExpressionBacterialPromoterpLlacO-1 and pLtetO-1Available SinceMay 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site3 (RTW549)
Plasmid#160138PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #3DepositorInsertAsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only