We narrowed to 14,481 results for: cas9
-
Plasmid#237465PurposeAll-in-one base editor expressing adenine base editor (ABE8e-nSaCas9) and sgRNA control targeting Intergenic siteDepositorInsertIntergenic sgRNA
UseCRISPRExpressionMammalianPromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX461-ABE8e-nSpCas9-NRF1-ss-sgRNA
Plasmid#237466PurposeAll-in-one adenine base editor (ABE8e-nSpCas9) with gRNA targeting NRF1-Ex7 splice siteDepositorInsertgRNA targeting NRF1-Ex7 splice site
UseCRISPRExpressionMammalianPromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX461-evoCDA1-nSpCas9-NRF1-ss-sgRNA
Plasmid#237467PurposeAll-in-one cytosine base editor (evoCDA1-nSpCas9) with sgRNA targeting NRF1-Ex7 splice siteDepositorInsertsgRNA targeting NRF1-Ex7 splice site
UseCRISPRExpressionMammalianPromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX462-ABE8e-nSaCas9-NRF1-ss-sgRNA
Plasmid#237468PurposeAll-in-one adenine base editor (ABE8e-nSaCas9) with gRNA targeting NRF1-Ex7 splice siteDepositorInsertgRNA targeting NRF1-Ex7 splice site
UseCRISPRExpressionMammalianPromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA074 Cas9-BFP/HBB_IVS2/BFP
Plasmid#249135PurposeOverexpression of SpCas9-BFP with HBB IVS2 intron within BFP coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertCas9-TagBFP/HBB_IVS2/TagBFP (HBB Human, S. pyogenes Cas9, synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-mCherry-enCas9(D10A)-PolI5MΔ
Plasmid#249068PurposeExpresses nucleus-localized enCas9 (D10A) fused to PolI5MΔ and mCherry using a CMV promoter. Includes a GFP cassette flanked by BsmbI cut sites to knock in and coexpress user-defined gRNAs.DepositorInsertenCas9-PolI5MΔ
UseCRISPRTagsmCherryExpressionMammalianMutationdeletion of PolI5M N-terminal flap endonuclease d…PromoterCMVAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-DIO-SaCas9-U6-sgDaglb
Plasmid#240023PurposeKnockdown expression of DaglbDepositorAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-DIO-SaCas9-U6-sgDagla
Plasmid#239421PurposeKnockdown expression of DaglaDepositorAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
EKv444(pIhcsrI677-Cas9 GG destination vector )
Plasmid#248344PurposeGolden Gate destination vector containing S. pyogenes Cas9 nuclease (with BsaI sites removed). For multicassette gRNA assembly and expression in moss Physcomitrium patens (Physcomitrella).DepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
-
pEvolvR-mCherry-enCas9(D10A)-PolI5M
Plasmid#249060PurposeExpresses nucleus-localized enCas9 (D10A) fused to PolI5M and mCherry using a CMV promoter. Includes a GFP cassette flanked by BsmbI cut sites to knock in and coexpress user-defined gRNAs.DepositorInsertenCas9-PolI5M
UseCRISPRExpressionMammalianAvailable SinceDec. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
H1_sgRNA(GRIN2B)_SauCas9_AcrIIA5-AsLOV2(N77)
Plasmid#246056PurposeExpression of a sgRNA targeting the GRIN2B locus, a SauCas9 and an AcrIIA5-cpGR2 hybrid (insertion before N77) linked through a P2A sequence, under the same pol-III H1 promoterDepositorInsertSauCas9, sgRNA(GRIN2B) and AcrIIA5_AsLOV2-N77
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
H1_sgRNA(GRIN2B)_SauCas9_AcrIIA5-AsLOV2(D41)
Plasmid#246055PurposeExpression of a sgRNA targeting the GRIN2B locus, a SauCas9 and an AcrIIA5-cpGR2 hybrid (insertion before D41) linked through a P2A sequence, under the same pol-III H1 promoterDepositorInsertSauCas9, sgRNA(GRIN2B) and AcrIIA5_AsLOV2-D41
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEf1a-Dn29-dCas9-P2A-GFP
Plasmid#247155PurposeMammalian expression of a human codon optimized wildtype Dn29 recombinase fused to dCas9 and gRNA expression cassette for targeting attH1 with H1-g3DepositorInsertDn29-dCas9-P2A-GFP
TagsSV40 NLSExpressionMammalianPromoterEf1aAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3G-ZIM3-Cas9-P2A-GFP
Plasmid#239605PurposeDoxycycline inducible CRISPRgenee constructDepositorAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1as-ZIM3-Cas9-P2A-GFP
Plasmid#239603PurposeConstitutive active CRISPRgenee constructDepositorInsertZIM3 KRAB domain (ZIM3 )
UseCRISPR and LentiviralAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB_Mut(D1399Y)_p300_core-dCas9-EGFP_hygro
Plasmid#226427PurposePiggyBac transposon vector containing a dox inducible mutant p300 core-dCas9 fusion protein (p300 core mutation: D1399Y) and EGFP reporter. Hygromycin selection marker.DepositorInsertsMutant p300 core-dCas9-EGFP fusion protein
rtTA3-IRES-Hygro
UseCRISPR and Synthetic Biology; Piggybac transposonTagsHA tag, Mutant p300 core, and P2A-EGFPExpressionMammalianMutationp300 core mutation (D1399Y)PromoterDox inducible minimal CMV and UbC PromoterAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-E14-ABE-Cas9n-puro
Plasmid#226588PurposeExpress E14-ABE in mammalian cellsDepositorInsertE14-ABE
UseCRISPRExpressionMammalianAvailable SinceAug. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
nzCas9n-GSG-linker-P2A-mNeongreen
Plasmid#241189PurposeMiddle entry vector for mini-Golden subcloning platform; mNeongreenDepositorInsertmNeongreen
UseMini-goldenMutationTCGC linkerAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only