We narrowed to 6,040 results for: SUP
-
Plasmid#225884PurposeEnhancer reporterDepositorInserthR3-16
TagsEGFPExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Vsx2 mR0-37 +SV40 base prom-GFP-IRES-AP
Plasmid#225885PurposeEnhancer reporterDepositorInsertmR0-37
TagsEGFPExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Vsx2 mR1-28 +SV40 base prom-GFP-IRES-AP
Plasmid#225886PurposeEnhancer reporterDepositorInsertmR1-28
TagsEGFPExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Vsx2 mR2-22 +SV40 base prom-GFP-IRES-AP
Plasmid#225887PurposeEnhancer reporterDepositorInsertmR2-22
TagsEGFPExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Vsx2 mR3-17 +SV40 base prom-GFP-IRES-AP
Plasmid#225888PurposeEnhancer reporterDepositorInsertmR3-17
TagsEGFPExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-L1374
Plasmid#226278PurposePlasmid expressing the SSD1 allele from L-1374, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
p8270 LentiCRISPR v2 hygro sgSIGIRR-3
Plasmid#193979PurposeExpression of spCas9 and sgRNA targeting SIGIRRDepositorInsertspCas9 and sgRNA targeting SIGIRR (SIGIRR Human)
UseLentiviralAvailable SinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-NCYC110
Plasmid#226273PurposePlasmid expressing the SEC22 allele from NCYC110, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-L1374
Plasmid#226271PurposePlasmid expressing the SEC22 allele from L-1374, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-UWOPS872421
Plasmid#226272PurposePlasmid expressing the SEC22 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-S288C
Plasmid#226270PurposePlasmid expressing the SEC22 allele from S288C, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEM_ΔndhD2.km
Plasmid#185532Purposea pGEM-T easy vector containing the kanamycin resistance cassette flanked by the two regions for the double homologous recombination on the ndhD2 locusDepositorInsertnptII gene flanked by ndhD2 upstream and downstream regions
UseSynthetic BiologyAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEM_Δflv3.sm
Plasmid#185533Purposea pGEM-T easy vector containing the streptomycin/spectinomycin resistance cassette flanked by the two regions for the double homologous recombination on the flv3 locusDepositorInsertaadA gene flanked by flv3 upstream and downstream regions
UseSynthetic BiologyAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-NCYC110
Plasmid#226279PurposePlasmid expressing the SSD1 allele from NCYC110, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRS-GFP
Plasmid#220197Purposemini-Tn7 GFP expression vectorDepositorInsertmonomeric superfolder green fluorescent protein
UseCRISPRExpressionBacterialMutationmonomeric superfolder green fluorescent proteinPromoterpromoterlessAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-IvfChr-citrine
Plasmid#221614PurposeA recombinant AAV2 plasmid encoding vfChrimson-citrine with trafficking enhancement.DepositorInsertvfChrimson-citrine with membrane trafficking enhancement
UseAAVMutationvfChrimson with membrane trafficking enhancementPromoterHuman SynapsinAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-ZipT-mScarlet-KV2.1
Plasmid#221617PurposeA recombinant AAV2 plasmid encoding the ZipACR I151V mutant and soma targeting with KV2.1 motif.DepositorInsertZipACR (I151T)-mScarlet with soma targeting
UseAAVMutationZipACR (I151T) with soma targetingPromoterHuman SynapsinAvailable SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-ZipV-mScarlet-KV2.1
Plasmid#221616PurposeA recombinant AAV2 plasmid encoding the ZipACR I151T mutant and soma targeting with KV2.1 motif.DepositorInsertZipACR (I151V)-mScarlet with soma targeting
UseAAVMutationZipACR (I151V) with soma targetingPromoterHuman SynapsinAvailable SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
His-GST-ATG13 (363-517)
Plasmid#222823PurposeBacteria expression of His-GST -ATG13 C-terminalDepositorAvailable SinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only