We narrowed to 968 results for: Gatc
-
Plasmid#183268PurposeAll-in-One CRISPRko system with a guide RNA that targets ABL2 geneDepositorInsertABL2
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AasgRNA3.8.3
Plasmid#121959PurposeMammalian expression, Transcription regulation, gRNA scaffoldDepositorInsertAaCas12b single chimeric gRNA, MS2 hairpin inserted
ExpressionMammalianAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
shCDK6(2)
Plasmid#73553PurposeshRNA(2) against CDK6DepositorInsertshRNA against CDK6
UseRetroviralExpressionMammalianPromoterLTRAvailable SinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_INT[GFPApt]
Plasmid#68428PurposeTransient expression in mammalian cells of an "INT" construct_bearing the GFP aptamer, targeting the GLuc reporter. U6 promoterDepositorInsertINT construct_bearing the GFP aptamer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_INT[3xK-T]
Plasmid#68429PurposeTransient expression in mammalian cells of an "INT" construct_bearing three kink-turns, targeting the GLuc reporter. U6 promoterDepositorInsertINT construct_bearing three kink-turns
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSSBIO32_dCas9_RPA3717
Plasmid#240491PurposeCRISPRi-mediated Knockdown of RPA3717DepositorInsertCas9 (cas9 Streptococcus pyogenes)
UseCRISPRExpressionBacterialMutationD10A, H840APromoterPlacAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
GOLIM4 g1 LentiCRISPRv2-mCherry
Plasmid#218662PurposeKnockout vector for human GOLIM4 (GPP130/GOLPH4)DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgNFkBIA guide 1
Plasmid#193595PurposeNFkBIA knockoutDepositorInsertsgNFkBIA guide 1 (NFKBIA Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgNFkBIA guide 2
Plasmid#193596PurposeNFkBIA knockoutDepositorInsertsgNFkBIA guide 2 (NFKBIA Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330A-T#1
Plasmid#171515Purposedeletion of a genomic locus in T(Brachyury) geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_MTOR
Plasmid#183311PurposeAll-in-One CRISPRko system with a guide RNA that targets MTOR geneDepositorInsertMTOR
UseLentiviralAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
shRNA-Ratio-PosCon
Plasmid#183553PurposeDesigned to test the efficacy of shRNA by assessing the ratio of GFP-fusion protein to RFP (shRNA ratio positive control (Pbrm1), Figure S2)DepositorInsertPbrm1 shRNA
ExpressionMammalianPromoterCBhAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_FLT1
Plasmid#183292PurposeAll-in-One CRISPRko system with a guide RNA that targets FLT1 geneDepositorInsertFLT1
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056F
Plasmid#183134PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii tra, Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[tra]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_RARA
Plasmid#183318PurposeAll-in-One CRISPRko system with a guide RNA that targets RARA geneDepositorInsertRARA
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_JAK1
Plasmid#183302PurposeAll-in-One CRISPRko system with a guide RNA that targets JAK1 geneDepositorInsertJAK1
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP1
Plasmid#113972PurposeSingle short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLY133
Plasmid#130961PurposeEngineered sgRNA-LEB4 generator including Anderson promoter J23100 for golden gate assemblyDepositorInsertsgRNA-LEB4
UseSynthetic BiologyExpressionBacterialPromoterAnderson promoter J23100Available SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCR1323
Plasmid#111125PurposeExpresses non-targeting_01224 sgRNA in pCR1068DepositorInsertNon-targeting gRNA
UseLentiviralAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only