We narrowed to 7,159 results for: GFP expression plasmids
-
Plasmid#107886PurposeR4 plasmid. Contains PBAD-EGFP-151TGA and is part of the CAMERA system for rewritable multi-event analog recording in bacteriaDepositorInsertPBAD-EGFP-151TGA
ExpressionBacterialAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pWT004b
Plasmid#107884PurposeR2 plasmid. Contains PBAD-EGFP-151TGA and is part of the CAMERA system for rewritable multi-event analog recording in bacteriaDepositorInsertPBAD-EGFP-151TGA
ExpressionBacterialAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pED17x11
Plasmid#134814PurposesfGFP expression plasmid for characterizing qtRNA chargingDepositorInsertsfGFP-151-TAGA
UseSynthetic BiologyTags6xHisExpressionBacterialMutation151-TAGAAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEM7067
Plasmid#214005PurposePrpsM driven expression of ssrA-tagged eGFP (AAV)DepositorInserteGFP-AAV
ExpressionBacterialPromoterPrpsMAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMIA10.7
Plasmid#214451PurposeBxbI landing-pad Tet-On-T2A-puro-pA pA-GFP-TRE3G donor. Use with BxbI expressing plasmid to swap payload into 4.721 landing-pad. Generates inducible cell line.DepositorInsertsTet-On 3G
PuroR
TRE3G CopGFP
UseBxbi donorTagsPuroR, T2A, and Tet-On 3GAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINT2
Plasmid#127512PurposePlasmid encodes H. sapiens codon optimized Integrase 2.DepositorInsertIntegrase 2 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINT9
Plasmid#127516PurposePlasmid encodes H. sapiens codon optimized Integrase 9.DepositorInsertIntegrase 9 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINT13
Plasmid#127517PurposePlasmid encodes H. sapiens codon optimized Integrase 13.DepositorInsertIntegrase 13 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ889
Plasmid#84826PurposeMinimos transposon with Psmu-1:smu-1:GFP:smu-1 UTR and cbr-unc-119 selectionDepositorAvailable SinceJan. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMSCV/CALR del52-linker-Venus-KDEL
Plasmid#214786PurposeMammalian expression of human del52-linker-Venus-KDELDepositorAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV/CALR ins5-linker-Venus-KDEL
Plasmid#214787PurposeMammalian expression of human CALR ins5-linker-Venus-KDELDepositorAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV/CALR del52-linker-Venus
Plasmid#214788PurposeMammalian expression of human CALR del52-linker-VenusDepositorAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV/CALR ins5-linker-Venus
Plasmid#214789PurposeMammalian expression of human CALR ins5 -linker-VenusDepositorAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW-MRTFA-HA
Plasmid#247436PurposesiRNA resistant HA-tagged mouse MRTF-A cloned into the pCW backbone (Addgene #41393, with puromycin resistance) together with an IRES GFP to indicate doxycycline-inducible expression by fluorescence.DepositorInsertsUseLentiviral; Dox-inducibleTagsHAExpressionMammalianMutationsiRNA resistant - no amino acid mutationsAvailable SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW-Rho(G14V)-HA
Plasmid#247437PurposeHA-tagged human RhoA(G14V) cloned into the pCW backbone (Addgene #41393, with puromycin resistance) together with an IRES GFP to indicate doxycycline-inducible expression by fluorescence.DepositorInsertsUseLentiviral; Dox-inducibleTagsHAExpressionMammalianMutationG14V mutation (constitutive active mutant)Available SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW-CDK1-HA
Plasmid#247438PurposeHA-tagged mouse CDK1 cloned into the pCW backbone (Addgene #41393, with puromycin resistance) together with an IRES GFP to indicate doxycycline-inducible expression by fluorescence.DepositorAvailable SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW-CKS2-HA
Plasmid#247439PurposeHA-tagged mouse CKS2 cloned into the pCW backbone (Addgene #41393, with puromycin resistance) together with an IRES GFP to indicate doxycycline-inducible expression by fluorescence.DepositorAvailable SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW-Myoferlin-HA
Plasmid#247440PurposeHA-tagged human Myoferlin cloned into the pCW backbone (Addgene #41393, with puromycin resistance) together with an IRES GFP to indicate doxycycline-inducible expression by fluorescence.DepositorInsertsUseLentiviral; Dox-inducibleTagsHAExpressionMammalianAvailable SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINT4
Plasmid#127513PurposePlasmid encodes H. sapiens codon optimized Integrase 4.DepositorInsertIntegrase 4 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINT5
Plasmid#127514PurposePlasmid encodes H. sapiens codon optimized Integrase 5.DepositorInsertIntegrase 5 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
AP682-1
Plasmid#70050PurposeExpresses TEV::eGFP::myc::3Xflag in bacteriaDepositorInserteGFP
TagsTEV and myc::3XflagExpressionBacterialAvailable SinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBA2675
Plasmid#189997PurposeInducible expression of FBP75 (1–200)-NLS-VhhGFP4, integrate at 177 bp, phleomycin marker (deGradFP for nuclear proteins)DepositorInsertsFBP75
VhhGFP4
UseExpression vector for trypanosoma bruceiTagsNLSMutationN-terminal 600 bp of FBP75Available SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBA2705
Plasmid#189998PurposeInducible expression of FBP75(1–200)-VhhGFP4, integrate at 177 bp, phleomycin marker (deGradFP for cytoplasmic proteins)DepositorInsertsFBP75
VhhGFP4
UseExpression vector for trypanosoma bruceiMutationN-terminal 600 bp of FBP75Available SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKM493
Plasmid#140191PurposeORBIT integrating plasmid for C-terminal tagging with cleavable EGFP.DepositorInsertTEV-Flag-Gly4-eGFP
TagsFlag + eGFPExpressionBacterialPromoterPGroELAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEMS1424
Plasmid#29220PurposeThe plasmid contains the Pleaides (Ple) MiniPromoter Ple155 derived from the human PCP2 gene and designed for expression in ON Bipolar cells of the retina.DepositorInsertPle155-EGFP-NLS
UseHigh copy number homologous recombination plasmid…ExpressionMammalianPromoterMiniPromoter Ple155 from the human PCP2 geneAvailable SinceNov. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pM162
Plasmid#173221PurposeExpresses ScFV-GCN4-GFP10M2-GB1-T2A-OptGFP(1-9)-GB1 and Puro-T2A-MCP-mCherry-GFP11-GB1DepositorInsertsScFV-GCN4-GFP10M2-GB1-T2A-OptGFP (1-10)-GB1
MCP-mCherry-GFP11-GB1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromoterCMVAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBD21_035
Plasmid#109152PurposepL2 plasmid backbone for assembly of a transcription unit along with constitutive expression of EGFPDepositorInsertsmRFP
EGFP
UseSynthetic BiologyExpressionBacterial and MammalianPromoterCMV and pTetAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMAT_41BBICD
Plasmid#197097PurposeThis plasmid contains the coding sequence for the intracellular domain of 4-1BB. Digest this insert and add it to pHR_pSFFV_scFVCD19_CD8a_CD3zP2AEGFPDepositorInsertThis plasmid contains the coding sequence for the intracellular domain of 4-1BB.
ExpressionMammalianAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed Free NES (M)
Plasmid#182437PurposeYeast integrative plasmid for expressing ERG20(F96W-N127W) (GAL10 promoter) and AcNES1 (GAL7 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsFPPS(M)
NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10 and GAL7Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-Antares2
Plasmid#120868PurposePiggybac transposon plasmid for live animal optical imagingDepositorInsertpcDNA3-Antares2
ExpressionMammalianMutationAntares2 ampliconPromoterCAG PromoterAvailable SinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
rAAV-CAG::FLEX-rev:ChR2HA:2a:PSAML141F,Y115F:GlyR
Plasmid#32483PurposeCre-dependent expression of ChR2 and PSAM-GlyR (L141F,Y115F) neuronal inhibitor, with IRES-EGFP markerDepositorInsertChR2HA-2a-PSAML141F,Y115F:GlyR
UseAAV and Cre/Lox; Adeno-associated virus, flex swi…TagsChR2 2APromoterCAGAvailable SinceApril 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP973-1
Plasmid#99496PurposeTEV::linker::meGFP:3XFlagDepositorInsertTEV::linker::meGFP::3XFlag
ExpressionBacterialAvailable SinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAP758-1
Plasmid#99494PurposeTEV::eGFP::3XFlagDepositorInsertTEV::eGFP::3XFlag
ExpressionBacterialAvailable SinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAP996-1
Plasmid#99499Purpose3XFlag::meGFP::linker::TEVDepositorInsert3XFlag::meGFP::linker::TEV
ExpressionBacterialAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAP835-1
Plasmid#99495PurposeTEV::meGFP::3XFlagDepositorInsertTEV::meGFP::3XFlag
ExpressionBacterialAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-Flp-DOG-NW (AAV1)
Viral Prep#75469-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-EF1a-Flp-DOG-NW (#75469). In addition to the viral particles, you will also receive purified pAAV-EF1a-Flp-DOG-NW plasmid DNA. EF1a-driven expression of Flp recombinase dependent on GFP (Flp-DOG); to be coinjected with GFP (or for use with transgenic GFP animals). These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF-1aAvailable SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTN4
Plasmid#174212PurposeDonor plasmid for introducing Peft-3::AtTIR1(F79G)::mRuby at the ttTi5605 locusDepositorAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pB PUb-integrase
Plasmid#183966PurposepiggyBac plasmid for insect transformation, expressing PhiC31 integrase under control of the Aedes aegypti PUb promoter, GFP fluorescent markerDepositorInsertPhiC31 integrase
UsePiggybac insect transgenesis destination vectorPromoterAedes aegypti PolyubiquitinAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRosa26-GT
Plasmid#40025DepositorInsertsGFP
beta-globin intron
Neo
tdT-3Myc
diphteria toxin A
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta globin promoter and CMV enhance…Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only