We narrowed to 4,724 results for: GCA
-
Plasmid#195109PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting the RPB1 C-term. Puromycin selection (2A-fusion).DepositorInsertsgRNA against last exon of RPB1 (C-terminal)
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
PPP2R2B B6.5 gRNA
Plasmid#90848Purpose3rd generation lentiviral gRNA plasmid targeting human PPP2R2BDepositorInsertPPP2R2B (Guide Designation B6.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Ptpn23-g1)-PGKpuroBFP-W
Plasmid#105034PurposeLentiviral gRNA plasmid targeting mouse Ptpn23 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pQCascade-IS186
Plasmid#140627PurposeExpresses V. cholerae TniQ, Cas8, Cas7, and Cas6 and crRNA-IS186. The crRNA-IS186 targets IS186 loci in Escherchia coli.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, crRNA-IS186
UseCRISPR; TransposonExpressionBacterialAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_Dual_pegRNA
Plasmid#173199PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 Q118R-G4 pegRNA with a user-specified pegRNA from two independent U6 promoters. pU6-pegRNA-GG-acceptor-like plasmidDepositorInsertATP1A1 G4 Q118R pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA3-RPB1-N-term
Plasmid#195112PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting the RPB1 N-term. Puromycin selection (2A-fusion).DepositorInsertsgRNA against first exon of RPB1 (N-terminal)
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA1-RPB1-N-term
Plasmid#195110PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting the RPB1 N-term. Puromycin selection (2A-fusion).DepositorInsertsgRNA against first exon of RPB1 (N-terminal)
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
CS2 luc Fstl1
Plasmid#13497DepositorInsertFstl1 (Fstl1 Mouse)
UseLuciferaseMutationcontains 3 tandem copies of the following sequenc…Available SinceDec. 29, 2006AvailabilityAcademic Institutions and Nonprofits only -
PAX6 sgRNA7
Plasmid#68466Purposetargeting PAX6 geneDepositorAvailable SinceNov. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
-962 human cyclin D1 promoter TCF (0)-(4) sites mutant pGL3Basic
Plasmid#32737DepositorInsertCCND1 promoter (CCND1 Human)
UseLuciferaseMutation-539 TCF(0) ATGAAAG deletion; -75 TCF(1) and -68 …Promoter-962 CCND1Available SinceJan. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgMYC guide 2
Plasmid#193597PurposecMYC knockoutDepositorInsertsgMYC guide 2 (MYC Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX458-sgRNA_Ago1_1
Plasmid#73533PurposeExpresses SpCas9, GFP, and sgRNA targeting Ago1DepositorInsertAGO1
UseCRISPRExpressionMammalianPromoterhU6Available SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-SLC35B2-sgRNA
Plasmid#154860PurposeLentiviral expression of Cas9 and sgRNA targeting SLC35B2DepositorAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
sg1+sg2+sg3
Plasmid#113969PurposeTriple short guide RNA targeting GTATAGCATACATTATACG, TACCACATTTGTAGAGGTT & CAATGTATCTTATCATGTCDepositorInsertsg1+sg2+sg3
ExpressionMammalianPromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
plKO.1-DNAJC5-ShRNA
Plasmid#205729PurposeKnockdown of DNAJC5DepositorInsertshRNA targeting DNAJC5 (DNAJC5 Human)
UseLentiviralAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJG367
Plasmid#91185PurposeBeYDV replicon T-DNA for gene targeting in tobacco leaves, H840A double nickase (nAtCas9_H840A+gNt_R2+gNt_F2+donor)DepositorInsertnAtCas9_H840A+gNt_R2+gNt_F2+donor
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJG382
Plasmid#91189PurposeBeYDV replicon T-DNA for gene targeting in tobacco leaves, D10A double nickase (nAtCas9_D10A+gNt_R2+gNt_F2+donor)DepositorInsertnAtCas9_D10A+gNt_R2+gNt_F2+donor
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR/U6 HDAC4 shRNA
Plasmid#32220DepositorAvailable SinceSept. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-TUBA1B_sgRNA
Plasmid#183889PurposepX459V2.0-HypaCas9 plasmid with TUBA1B sgRNA for N-terminal tagging of alpha-tubulin in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only