We narrowed to 27,989 results for: grna
-
Plasmid#117411PurposeAsCas12a-gRNA targeting TLR2.0DepositorInsertAsCas12a gRNA targeting TLR 2.0
UseLentiviralExpressionMammalianPromoterU6Available sinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-egfp-U3-Osp.gRNA
Plasmid#166034PurposeEmpty backbone for expression of gRNA-expressing integration deficient lentiviral particles.DepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable sinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiGuidPuro-hTP53_sgRNA-1
Plasmid#88853PurposeCRISPR KO of Trp53DepositorInsertTrp53
UseCRISPR and LentiviralExpressionMammalianAvailable sinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 6
Plasmid#51765PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 6
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available sinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Lenti-sgLats1#2/Cre
Plasmid#173600PurposeExpresses a Lats1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Lats1 (Lats1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgLats1#1/Cre
Plasmid#173599PurposeExpresses a Lats1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Lats1 (Lats1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPole#2/Cre
Plasmid#173610PurposeExpresses a Pole-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Pole (Pole Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPole#1/Cre
Plasmid#173609PurposeExpresses a Pole-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Pole (Pole Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSetd2#1/Cre
Plasmid#89649PurposeExpresses a Setd2-targeting gRNA and Cre-recombinaseDepositorAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_RNF123
Plasmid#127122DepositorInsertgRNA RNF123 (RNF123 Human)
UseCRISPRAvailable sinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTC362
Plasmid#91216Purposeprotoplast vector for targeted deletion of 6 genes in tomatoDepositorInsertgRNAs targeting 6 tomato genes
UseCRISPRExpressionPlantAvailable sinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pADH139
Plasmid#90987PurposeNAT-marked "empty" gRNA construct for use in gRNA expression cassette stitching PCR; use with pADH110 to generate target-specific part 2 of 2 for C.mal LEUpOUT CRISPR system.DepositorInsertgRNA conserved, C, mal LEU2 2 of 2
UseCRISPRAvailable sinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorPublicationAvailable sinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR_eGFP_497
Plasmid#111824PurposeKnockout eGFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA targeting eGFP 477-497
UseCRISPRTagsmCherryExpressionBacterial and MammalianPromoterU6Available sinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgPBRM1-2- LentiCRISPRv2
Plasmid#107404PurposeLentiviral expression of Cas9 and gRNA targeting PBRM1DepositorInsertgRNA targeting PBRM1 (PBRM1 Human)
UseLentiviralAvailable sinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-L3US2-RFP-HDAC3
Plasmid#83966PurposeLentiviral CRISPR HDAC3 dual gRNA targeting vectorDepositorAvailable sinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAdSh.U6.gRNAGFP
Plasmid#58255PurposeU6 promoter-driven single guide RNA complementary to eGFPDepositorInsertU6.gRNAGFP cassette
UseAdenoviral and CRISPRExpressionMammalianAvailable sinceSept. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
AOI-WT-Cas9-sg-mouse Suz12-F2-GFP
Plasmid#91882PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Suz12DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA targeting Suz12 (Suz12 Mouse)
UseCRISPRExpressionMammalianPromoterU6Available sinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only