We narrowed to 11,638 results for: nar
-
Plasmid#137714PurposeExpresses LbCas12a RVRR variant in mammalian cells.DepositorInsertLbCas12a-RVRR
Tags3xHA, NLS, and SV40 NLSExpressionMammalianMutationG532R, K538V, Y542R, K595RPromoterCMVAvailable SinceMarch 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUDE731
Plasmid#103008PurposeS. cerevisiae Episomal plasmid harboring Fncpf1 under the control of TDH3pDepositorInsertFncpf1
Tags3HA and NLSExpressionYeastMutationhuman codon optimizedPromoterTEF1Available SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUDE735
Plasmid#103024Purposeexpression of a Cpf1 programming crRNA targetting CAN1, HIS4, PDR12 and ADE2 (crCAN1-4.crHIS4-4.crPDR12-3.crADE2-3.S)DepositorInsertcrCAN1-4.crHIS4-4.crPDR12-3.crADE2-3.S
UseCRISPRExpressionYeastPromoterSNR52Available SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
QSOX1-Tol2
Plasmid#113383Purposeevaluate FOXA1 DIV motif enhancer activity near 50 kb of QSOX1 geneDepositorInsertQSOX1-enhancer (QSOX1 Human)
UseTol2 reporterAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-driven AcrIIA4-scaffold (2xBsmBI sites)
Plasmid#120297PurposeAAV vector for expression of AcrIIA4 (no miR binding sites, control vector)DepositorInsertAcrIIA4
UseAAV and CRISPRTagsFLAGExpressionMammalianAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-driven AcrIIA4-2xmiR-122 target sites
Plasmid#120298PurposeAAV vector for expression of AcrIIA4 with two miR-122 binding sitesDepositorInsertAcrIIA4-2xmiR-122 binding sites
UseAAV and CRISPRTagsFLAGExpressionMammalianAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKnockinDonor-humanCTCF-miniAID-mClover3
Plasmid#136883Purposeknockin donor vector of miniAID-mClover3 to C-terminus of endogenous human CTCFDepositorInsertCTCF-knockin-homology arm-miniAID-mClover3
TagsminiAID-mClover3ExpressionMammalianPromoterno promoterAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-AtTAS1c-D2-B/c
Plasmid#137884PurposePlant expression vector (2x35S) for direct cloning of synthetic trans-acting siRNAs into Arabidopsis thaliana TAS1c precursor into position downstream 3'D1[+]DepositorInsertAtTAS1c-D2-B/c
ExpressionPlantMutationA. thaliana TAS1c precursor sequence including a …Promoter2x35SAvailable SinceMay 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
IG510: pMVP (R4-R3) human PDX1
Plasmid#121744PurposepMVP R4-R3 entry plasmid, contains human PDX1 for 3- or 4-component MultiSite Gateway Pro assemblyDepositorInsertHuman PDX1 (PDX1 Human)
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
ScFv-2ERT2-V
Plasmid#120553Purpose3rd gen transfer vector. Encode an antibody that binds to the GCN4 peptide from the SunTag system, and is fused to sfGFP, 2 tandem ERT2 and VP64.DepositorInsertscFvGCN4, sfGFP, GB1, ERT2, VP64
UseLentiviralExpressionMammalianPromoterhPGKAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-TRBP-L1+D1+L2-myc/His
Plasmid#180599PurposeExpressing various parts of TRBPDepositorAvailable SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
KK501: pMVP (L3-L2) FKBP DD + polyA
Plasmid#121789PurposepMVP L3-L2 entry plasmid, contains FKBP DD + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows fusion of C-term FKBP degron domain (stabilized by SHLD1) to gene of interest.DepositorInsertFKBP Degron Domain + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KJ901: pMAGIC (R4-R3) NLS-(SrfI/PmeI)-NLS
Plasmid#121835PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS scaffold enabling addition of dCas9 mutants into pMAGIC. dCas9 can be inserted via unique SrfI/PmeI restriction sitesDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-Drosha1-390
Plasmid#62521PurposeC-terminal aa391-1374 of Drosha is deletedDepositorInserthuman Drosha with aa 391-1374 deleted (DROSHA Human)
TagsGFPExpressionMammalianMutationdeleted amino acids 391-1374Available SinceMarch 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
LLP790_αGCN4-EZH2-FL-CO
Plasmid#211784PurposeSunTag counterpart binding domain, aGCN4, fused to polycomb repressive complex subunit EZH2, with GFP selectionDepositorInsertSnoopCatcher-KRAB
Tags2xOLLASExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect KRAB e…PromoterpEF1a and pSV40Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCML 961
Plasmid#98848PurposepTriFC_aidB. Expresses protein-NYFP and 2MS2BD-5' UTR mStrawberry fusions in E. coli for Dual-fluorescence TriFC assay (ampR).DepositorInserts5' UTR + first 100 nucleotides of coding sequence of the aidB gene
csrA
ExpressionBacterialPromoterpLacOAvailable SinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDGB3_Omega2_Pnos:GR:LacIBD:Gal4AD:Tnos-OplacI:mini35S:RDF:Tnos (GB1678)
Plasmid#160642PurposeModule for the dexamethasone -inducible expression of PhiC31 phage recombination directionality factor (RDF) gene.DepositorInsertGRLacIBDGal4AD / RDF
UseSynthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterPnosAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-Drosha1-850
Plasmid#62522PurposeC-terminal aa851-1374 of Drosha is deletedDepositorInserthuman Drosha with aa 851-1374 deleted (DROSHA Human)
TagsGFPExpressionMammalianMutationdeleted amino acids 851-1374Available SinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
IX301: pMVP (L3-L2) myc epitope tag + polyA
Plasmid#121753PurposepMVP L3-L2 entry plasmid, contains myc epitope tag + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest.DepositorInsertmyc epitope tag + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only