We narrowed to 8,703 results for: PAN
-
Plasmid#117540PurposeLevel1 Golden Gate Cassette: sgRNA cassette for AsCas12a, targeting NbPDS gene in N. benthamianaDepositorInsertcrRNA (AsCas12a)
ExpressionPlantAvailable SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEPOR0SP0014
Plasmid#117524PurposeLevel0 Golden Gate part: CDS, SpCas9-KADepositorInsertSpCas9-KA (with stop codon)
UseCRISPRMutationK855AAvailable SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEPOR0SP0009
Plasmid#117522PurposeLevel0 Golden Gate part: CDS, SpCas9-p (no stop codon)DepositorInsertSpCas9-p (no stop codon)
UseCRISPRAvailable SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pICSL90005
Plasmid#117520PurposeLevel0 Golden Gate part: CDS, SpCas9-h (no stop codon)DepositorInsertSpCas9-h (no stop codon)
UseCRISPRAvailable SinceNov. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEPOR0SP0008
Plasmid#117535PurposeLevel0 Golden Gate part: CDS, AsCas12aDepositorInsertAsCas12a (with stop codon)
UseCRISPRTags3xHA and NLSAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET29b-clbI S178A
Plasmid#114159PurposeExpresses ClbI S178ADepositorInsertclbI
Tags6xHis and 6xHis-Thrombin siteExpressionBacterialMutationMutated S178 to AlaAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a-clbH-C-A2-PCP
Plasmid#114157PurposeExpresses ClbH-C-A2-PCPDepositorInsertclbH
Tags6xHis-thrombin-T7 tagExpressionBacterialMutationOnly contains the C-A2-PCP domains of ClbHAvailable SinceAug. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
miR766 in pcDNA3.1
Plasmid#78124PurposeMammalian expression of miR766DepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB2336
Plasmid#67541PurposeEasyClone system-based yeast integrative vector carrying loxP-flanked SpHIS5 marker, integration into S. cerevisiae XII-5 chromosomal location, USER site for cloning, amp resistanceDepositorTypeEmpty backboneUseCre/Lox; IntegrativeExpressionYeastAvailable SinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDS69
Plasmid#48367PurposeFLAG-intergenic region of TUB-HYG (modified from PMID 16269191)DepositorInsertFLAG-intergenic region of TUB-HYG (modified from PMID 16269191)
UseCre/Lox; Knockout in t. bruceiAvailable SinceJan. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pILGFP4G
Plasmid#104502PurposeUsed to evaluate the expression output of Saccharomyces cerevisiae PGM2 promoter with yEGFP used as the reporter geneDepositorInsertScPGM2 promoter-yEGFP
ExpressionYeastAvailabilityAcademic Institutions and Nonprofits only -
pILGFP4K
Plasmid#104506PurposeUsed to evaluate the expression output of Saccharomyces paradoxus GAL1 promoter with yEGFP used as the reporter geneDepositorInsertSpGAL1 promoter-yEGFP
ExpressionYeastAvailabilityAcademic Institutions and Nonprofits only -
pILGFP4O
Plasmid#104510PurposeUsed to evaluate the expression output of Saccharomyces paradoxus GAL2 promoter with yEGFP used as the reporter geneDepositorInsertSpdGAL2 promoter-yEGFP
ExpressionYeastAvailabilityAcademic Institutions and Nonprofits only -
pILGFP4P
Plasmid#104511PurposeUsed to evaluate the expression output of Saccharomyces pastorianus GAL2 promoter with yEGFP used as the reporter geneDepositorInsertSptGAL2 promoter-yEGFP
ExpressionYeastAvailabilityAcademic Institutions and Nonprofits only -
CaMCLC-His
Plasmid#111292Purposebacterial expressionDepositorInsert(S)-malyl-CoA/b-methylmalyl-CoA/(S)-citramalyl- CoA lyase
TagsHis tag, GGGSGGGSLEHHHHHHExpressionBacterialAvailabilityAcademic Institutions and Nonprofits only -
MsMUT_sgRNA1
Plasmid#111296PurposeCRISPR KO murine MUTDepositorInsertsgRNA1 against murine MUT
UseCRISPR and LentiviralExpressionMammalianAvailabilityAcademic Institutions and Nonprofits only -
MsMUT_sgRNA3
Plasmid#111297PurposeCRISPR KO murine MUTDepositorInsertsgRNA3 against murine MUT
UseCRISPR and LentiviralExpressionMammalianAvailabilityAcademic Institutions and Nonprofits only -
pMS114
Plasmid#215677PurposeEmpty repair plasmid for ChrI split hygromycinR landing padDepositorInsert5'HA + MCS + loxN + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS158
Plasmid#215679PurposeEmpty repair plasmid for ChrIII split hygromycinR landing padDepositorInsert5'HA + MCS + lox2272 + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only