We narrowed to 27,998 results for: STI
-
Plasmid#11634DepositorInsertmerlin (NF2 Human)
TagsGSTExpressionBacterialMutationCarboxy-terminal half of merlin isoform 1.Available SinceMay 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
FFiBlast MSCV Puro
Plasmid#68464PurposeRetroviral plasmid for establishment of blasticidin resistance Cre-reporter cell lineDepositorInsertBlasticidin Resistance
UseCre/Lox and RetroviralExpressionMammalianMutationInvertedPromoterLTRAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
L2-AA012
Plasmid#185751PurposeVector to introduce eGFP under control of pAaEF1a into the genome of the hornwort Anthoceros agrestis via Agrobacterium mediated transformation. eGFP contains a cell membrane localization tag.DepositorInsertsHygR2
eGFP
Tagsmembrane localization tag Lti6bExpressionPlantAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMC_mNG2(11)_BSDminus_F1
Plasmid#184163PurposeDonor cassette plasmid for high-throughput tagging, encoding an mNG2(11) synthetic exon in frame 1, as well as a blasticidin resistance gene for selection of genomic integrants.DepositorInsertsmNG2(11)
bsd
UseCRISPRAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pME-hygro-hPGAP3-3HA
Plasmid#50373PurposeExpress C-terminally triple HA tagged human PGAP3 in mammmalian cellsDepositorInsertPGAP3 post-GPI attachment to proteins 3 (PGAP3 Human)
Tags3x HAExpressionMammalianPromoterSR alphaAvailable SinceJuly 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
MPC11 IgG2b gene
Plasmid#127248PurposeExpresses intact IgG2b gene in mammalian cellsDepositorInsertIgG2b gene with exons and alt pAs (Ighg2b Mouse)
ExpressionMammalianAvailable SinceAug. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site3 (RTW549)
Plasmid#160138PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #3DepositorInsertAsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVH028
Plasmid#80393PurposeContains constitutive histidine kinase (pCon-Taz) with 4x SH3 scaffold domains + salicylate inducible phosphatase (Psal-CusSmut)DepositorUseSynthetic BiologyTagsFused by GS linkers to 4 SH3 domainsExpressionBacterialMutationGlycine 448 changed to Alanine, makes it primaril…Available SinceNov. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T merlin 340-590
Plasmid#11633DepositorInsertmerlin (NF2 Human)
TagsGSTExpressionBacterialMutationCarboxy-terminal half of merlin isoform 2.Available SinceMay 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T merlin 308-579
Plasmid#11632DepositorInsertmerlin (NF2 Human)
TagsGSTExpressionBacterialMutationCarboxy-terminal common domain of merlin.Available SinceMay 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
pWPXL-resNP1
Plasmid#65061PurposeConstitutive expression of NP1 resistant to silencing by RNAi with pLVTH-shNP1DepositorInsertNeuronal Pentraxin 1 (Nptx1 Rat)
UseLentiviralExpressionMammalianMutationG447A, C450T, A451T, G452C, C454A, C456A, C459GPromoterEF1alphaAvailable SinceOct. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAcBAc1-Ma-tfmW-RSA2
Plasmid#251519PurposeOrthogonal Methanomethylophilus alvus aaRS/tRNA-mediated incorporation of tfm-Tryptophan into sfGFP150TAG in HEK293T cellsDepositorInsertMa-tfmW-RSA2
ExpressionMammalianPromoterCMVAvailable SinceMarch 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPB-HA-hGABARAP
Plasmid#229741PurposeExpresses HA-tagged human GABARAP in mammalian cells. Stable expression with piggybac transposase.DepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO539
Plasmid#235752PurposeProtein expression of ScVPS30 and ScVPS38DepositorAvailable SinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO734
Plasmid#235753PurposeProtein expression of ScVPS30 and ZZ-ScVPS38DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO761
Plasmid#235760PurposeExpression of ScVPS38 delta BARA2 (320-440)-x3FLAG under its own promoterDepositorInsertVSP38 delta BARA2
Tags3xFLAGExpressionYeastMutationaa 320-440 deletedPromoterScVPS38 promoterAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO766
Plasmid#235763PurposeExpression of ScVPS38 delta BARA2 (320-440)-EGFP under its own promoterDepositorInsertVSP38 delta BARA2
TagsEGFPExpressionYeastMutationaa 320-440 deletedPromoterScVPS38 promoterAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO933
Plasmid#235765PurposeExpression of ScVPS34 delta C154-V202-3xFLAG under its own promoterDepositorInsertVPS34 delta C154-V202
Tags3xFLAGExpressionYeastMutationaa 154-202 deletedPromoterScVPS34 promoterAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRExT2A-NT-BTy
Plasmid#232206PurposeEndogenous tagging of genes by CRISPR/Cas9-mediated homologous recombination; for N-terminal tagging: BSD-3xTy-T2A-3xTyDepositorInsert3xTy
ExpressionBacterialAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only