We narrowed to 45,354 results for: cha
-
Plasmid#185347PurposeMembrane anchoring of UBE2G2 and co-IP. Encodes transmembrane domain of S. Cerevisiae Cue1p fused to MYC-UBE2G2 with C-terminal FLAG tagDepositorInsertCue1p/Ube2G2 fusion (internal MYC tag)
TagsFLAGExpressionMammalianAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
L2_2xNOP1gRNA-Cas9-CsA
Plasmid#136140PurposePlasmid with 2 different NOP1-gRNA. Targets 500 bp apart in the genome. To tranform Mp as CRISPR control. Contains Cas9 and HygRDepositorInsertp5-35S:HygR p5-MpU6:NOP1gRNA2 p5-MpU6:NOP1gRNA1 p5-MpEF1a:Cas9-NLS
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
deltaLoop-MIDAS
Plasmid#171605PurposeExpresses the SNAP-tagged MIDAS domain of S. pombe Mdn1 (a.a. 4381-4717) without the loop region (a.a. 4458-4496) in bacteria.DepositorInsertMIDAS domain of S. pombe Mdn1 (a.a. 4381-4717)
TagsHis6 tag and SNAP tagExpressionBacterialMutationReplaced amino acids 4458-4496 with ASGSGS linkerAvailable SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS313_ATP3G919C
Plasmid#120255PurposeExpression of ATP3-7 in yeastDepositorInsertATP3 (ATP3 Budding Yeast)
ExpressionYeastMutationG919 changed to C; Alanine 307 changed to ProlinePromoterATP3Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS313_ATP3mut
Plasmid#120256PurposeExpression of ATP3-67 in yeastDepositorInsertATP3 (ATP3 Budding Yeast)
ExpressionYeastMutationIsoleucine 304 changed to Asparagine; Alanine 307…PromoterATP3Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCCM’ ΔacRAF
Plasmid#162710PurposeSecond CCM operon lacking acRAF; Deletion of putative rubisco chaperone, acRAFDepositorInsertSecond CCM operon cloned from H. neapolitanus
ExpressionBacterialMutationpCCM' with a deletion of putative rubisco ch…PromoterPLtet0-1 promoterAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA2 R2896C
Plasmid#139511PurposePlasmid expressing a sgRNA to introduce BRCA2 R2896C using base editingDepositorInsertsgRNA to insert BRCA2 E2896C using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
KG#84
Plasmid#110878PurposeExpresses the C. elegans acy--1 P260S gain-of-function cDNA in ventral cord cholinergic motor neuronsDepositorInsertsunc-17beta promoter
acy-1 P260S gain-of-function cDNA
unc-54 3' control region with 1 artificial intron just upstream and 1 artificial intron in control region
ExpressionBacterialMutationChanged Proline to Serine at amino acid 260Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
KG#81
Plasmid#110876PurposeExpresses the C. elegans acy-1 P260S gain-of-function cDNA in body wall muscleDepositorInsertsmyo-3 promoter
acy-1 P260S gain-of-function cDNA
unc-54 3' control region with 1 artificial intron just upstream and 1 artificial intron in control region
ExpressionBacterialMutationChanged Proline to Serine at amino acid 260Available SinceJune 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
KG#83
Plasmid#110877PurposeExpresses the C. elegans acy--1 P260S gain-of-function cDNA pan-neuronallyDepositorInsertsrab-3 promoter
acy-1 P260S gain-of-function cDNA
unc-54 3' control region with 1 artificial intron just upstream and 1 artificial intron in control region
ExpressionBacterialMutationChanged Proline to Serine at amino acid 260Available SinceJune 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAT_g1 gRNA
Plasmid#86005Purposeplasmid vector encoding for U6-driven AAT_g1 gRNADepositorInsertpU6-AAT_g1 sgRNA
UseCRISPRExpressionMammalianPromoterpU6Available SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAT_g2 gRNA
Plasmid#86006Purposeplasmid vector encoding for U6-driven AAT_g2 gRNA (Z-allele specific)DepositorInsertpU6-AAT_g2 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
BRCA1-(219-408)
Plasmid#35067DepositorAvailable SinceApril 4, 2012AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-BI30
Plasmid#183749PurposeAAV-BI30 Rep-Cap plasmid for production of AAV-BI30, a capsid with tropism for CNS endothelial cells.DepositorInsertAAV9 modified with 7mer insertion between amino acids 588 and 589 of VP1
UseAAVMutationK449R, and NNSTRGG inserted between 588 and 589 o…Promoterp41Available SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Cre-3xmiR122-WPRE-HGHpA
Plasmid#183776PurposeAAV genome with a CAG driven Cre recombinase with mR122 target sequence repeats to reduce transgene expression in hepatocytes.DepositorInsertCre
UseAAVMutationNAPromoterCAGAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-SOX4
Plasmid#110360PurposeMammalian expression of FLAG-tagged SOX4DepositorAvailable SinceMarch 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPD0039_CROP-seq-CAR-Puro
Plasmid#242532PurposeCAR T screeningDepositorInsertCD19-BB CAR (CD19 Human)
UseLentiviralAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-BI-hTFR1
Plasmid#218796PurposeRepCap for AAV productionDepositorInsertAAV Rep-Cap BI-hTFR1
ExpressionMammalianAvailable SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCKO2
Plasmid#125518PurposeLentiviral backbone for cloning and expressing U6 driven sgRNAs with BsmBI cloning sites and puromycin selection.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-SV40NLSf-GFP-3xmiR122-WPRE-HGHpA
Plasmid#183775PurposeAAV genome with a CAG driven eGFP reporter with mR122 target sequence repeats to reduce transgene expression in hepatocytes.DepositorInsertNLS-GFP
UseAAVMutationNAPromoterCAGAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPD0035_CROPseq-CAR-Puro_CD19-28z
Plasmid#242983PurposeCD19-28z FMC63 CARDepositorInsertCD19-28z FMC63 CAR (CD19 Human)
UseLentiviralAvailable SinceNov. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
ORAI1-YFP T184M
Plasmid#114181PurposeORAI1 channel with C-terminal YFP, carrying the mutation T184M in the protein 3rd transmembrane domain, responsible for the channel overactivity and associated with tubular aggregate myopathy (TAM).DepositorAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/Ndi-1/myc-His
Plasmid#127503PurposeExpresses myc-tagged yeast Ndi-1 in mammalian cellsDepositorAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
Nsp3 -EGFP
Plasmid#165108Purposemammalian expression and localizationDepositorAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2_IRES2_EGFP_KCNQ2 var4
Plasmid#173154PurposeFor mammalian expression of KCNQ2 and creating variantsDepositorAvailable SinceSept. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
Nsp4-mCherry
Plasmid#165132Purposemammalian expression and localizationDepositorAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_WT
Plasmid#98657PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341DepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
Orf3a-mCherry
Plasmid#165138Purposemammalian expression and localizationDepositorAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Hb9-LMO3 (sbGLuc-VChR1-EYFP)
Plasmid#114103Purposefusion protein of Gaussia luciferase variant slow burn, Volvox channelrhodopsin-1, and enhanced yellow fluorescent protein (luminopsin LMO3) for bioluminescent optogeneticsDepositorInsertsbGLuc-VChR1-EYFP
UseAAVExpressionMammalianPromotermotoneuron-specific Homeobox 9 promoterAvailable SinceAug. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-BE3-P2A-GFP-PGK-Puro
Plasmid#110867PurposeLentiviral vector for constitutive expression of BE3-P2A-GFP (not codon optimized)DepositorInsertBE3
UseLentiviralMutationD10APromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFB2D
Plasmid#195286PurposeBicistronic DTR-EGFP fusion and Puromycin resistance for positive/negative selectionDepositorInsertDTR EGFP 2A Puro
ExpressionMammalianPromoterEFSAvailable SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFB2E
Plasmid#195288PurposeBicistronic HSV-TK-EGFP fusion and Puromycin resistance for positive/negative selectionDepositorInsertHSV-TK EGFP 2A Puro
ExpressionMammalianPromoterEFSAvailable SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV_NLS-SaCas9-NLS-VPR
Plasmid#68496PurposeAAV vector containing SaCas9 fused to VPRDepositorInsertSaCas9-VPR
UseAAV and CRISPRTagsVPRExpressionMammalianPromoterCMVAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
COVID-SARS2 NSP13
Plasmid#159614PurposeBacterial expression plasmid for COVID-SARS2 NSP13 helicaseDepositorInsertCovid-SARS2 Nsp13
TagsHis6-Zb-TEVExpressionBacterialMutationCodon-optimized for E. coli expressionPromoterT7 - LacOAvailable SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-FNLS-P2A-Puro
Plasmid#110841PurposeLentiviral vector for constitutive expression of FNLS in mammalian cells (codon optimized)DepositorInsertBE3RA-FNLS
UseLentiviralTags3X FLAGMutationD10A and NLS sequence at the N-terminusPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1 hSCN5A-L325R
Plasmid#145373Purposeexpresses mutant form of human Nav1.5 (L325R) found in patient with Brugada syndrome in mammalian cellsDepositorInsertsodium voltage-gated channel alpha subunit 5 (SCN5A Human)
ExpressionMammalianMutationchanged Leucine 325 to ArgininePromoterCMVAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMEL12
Plasmid#107918Purposehph based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
Nsp6-mCherry
Plasmid#165133Purposemammalian expression and localizationDepositorAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-KTN1-WPRE-UbC-Emerald
Plasmid#225941PurposeLentiviral vector plasmid expressing human kinectin 1 (KNT1) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only