We narrowed to 168,206 results for: Gene
-
Plasmid#31992DepositorTypeEmpty backboneExpressionMammalianAvailable SinceSept. 13, 2011AvailabilityAcademic Institutions and Nonprofits only
-
pZP05
Plasmid#232319PurposepZP05 was constructed by cloning the oriFn-repA fragment from pCWU6 into the smaller suicide plasmid pCM-galK, facilitating replication in Fusobacterium nucleatumDepositorInsertOri-repA
ExpressionBacterialAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti puro HA-H2BC11
Plasmid#227588PurposeLentiviral plasmid expressing human H2BC11 proteinDepositorAvailable SinceNov. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIplac211-Kar2-moxGFP2-HDEL
Plasmid#218970PurposeGene replacement plasmid to label S. cerevisiae Kar2 with moxGFP2DepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-nrip1b
Plasmid#192732PurposeGateway entry vector encoding zebrafish nrip1bDepositorInsertnrip1b (nrip1b Zebrafish)
UseGateway entry vectorMutationL661P (rs511527097); S720P; A801T; K862E; A863P; …PromoterNoneAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJK561
Plasmid#72283PurposeProduces Acetobacter aceti 1023 thioredoxin with Cys35>Ser mutant (AaTrxA-C35S)DepositorInsertthioredoxin
ExpressionBacterialMutationchanges cysteine-35 to serinePromoterT7Available SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJK523
Plasmid#72442PurposeProduces Acetobacter aceti 1023 small hypothetical protein adjacent to purEK genes, with N-terminal His6 tag (H6AaOrfX)DepositorInserthypothetical protein
TagsHis6ExpressionBacterialMutationsynthetic gene with ~40 silent substitutionsPromoterT7Available SinceMarch 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJK590
Plasmid#71698PurposeProduces Acetobacter aceti 1023 thioredoxin reductase 1 with a C-terminal His6 tag (AaTrxB1H6)DepositorInsertthioredoxin reductase 1
TagsHis6ExpressionBacterialPromoterT7Available SinceJan. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-49: MYL2-mEGFP
Plasmid#114414PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human MYL2, via Cas9-excisable CAGGS-mCherry selection cassetteDepositorInsertMYL2 Homology Arms with linker-mEGFP and Cas9-excisable selection cassette (MYL2 Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PHFF-sh-hBVRA
Plasmid#100285PurposeExpression vector for phycocyanobilin (PCB) synthesis and shRNA for human BVRA gene in mammalian cellsDepositorInsertsMTS-PcyA-FLAG-P2A-MTS-HA-HO1-P2A-MTS-Myc-Fd-P2A-MTS-Fnr-T7 (synthetic genes)
shRNA for human BVRA
TagsFLAG, T7 and Mitochondria-targeting sequence (MTS…ExpressionMammalianMutationAll genes are codon-optimized for expression in h…PromoterCAG promoter and H1 promoterAvailable SinceSept. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-46: MYL7-mEGFP
Plasmid#114413PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human MYL7, via Cas9-excisable CAGGS-mCherry selection cassetteDepositorInsertMYL7 Homology Arms with linker-mEGFP and Cas9-excisable selection cassette (MYL7 Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PHFF-sh-mBVRA
Plasmid#100286PurposeExpression vector for phycocyanobilin (PCB) synthesis and shRNA for mouse BVRA gene in mammalian cellsDepositorInsertsMTS-PcyA-FLAG-P2A-MTS-HA-HO1-P2A-MTS-Myc-Fd-P2A-MTS-Fnr-T7 (synthetic genes)
shRNA for mouse BVRA
TagsFLAG, T7 and Mitochondria-targeting sequence (MTS…ExpressionMammalianMutationAll genes are codon-optimized for expression in h…PromoterCAG promoter and H1 promoterAvailable SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
iMb-Notch-Mosaic (IR99.40)
Plasmid#99749PurposeRosa26 gene targeting vector to induce a Cre-dependent mosaic of cells expressing different membrane localized fluorescent proteins and Notch signalling genesDepositorInsertMbYFP, MbTomato, MbKate2, DN-Rbpj and NICD-PEST
UseCre/Lox and Mouse TargetingExpressionMammalianAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHL-EF1a-SphcCas9(D10A)-iP-A
Plasmid#60600PurposeExpresses D10A mutant (nickase) of human codon-optimized Cas9 (derived from Streptococcus pyogenes) and pruomycin resistance gene.DepositorInsertsCRISPR Cas9 D10A
puromycin resistance gene
UseCRISPRExpressionMammalianMutationChanged Asp 10 to Ala, Codon usage optimized for …Available SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLY70
Plasmid#130948PurposeA CRISPR activation device with the necessary genes (dxcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter PrhaB), and the reporter part (PpspA-LEA3B3 with sfgfp::ASV).DepositorInsertsdxcas9 (3.7)
tetR
rhaS
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9 for dCas9; Sy…PromoterPcon, PpspA-LEA3B3, PrhaB, and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY61
Plasmid#130928PurposeA CRISPR activation device with the necessary genes (dxcas9 3.7 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA1B1 with sfgfp::ASV).DepositorInsertsdxcas9 (3.7)
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9 for dCas9; Sy…PromoterAnderson promoter: J23106, PpspA-LEA1B1, and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGGG L2 TaStb15
Plasmid#226630PurposeWheat transformation vector used to express wheat Septoria tritici blotch (Stb) resistance gene 15DepositorInsertTriticum aestivum (wheat) Septoria tritici blotch 15 (TaStb15) disease resistance gene
UseSynthetic BiologyExpressionPlantPromoterNative TaStb15Available SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE
Plasmid#32702PurposeConditional overexpression vector. Deletion of dsRed by Cre recombinase results in the rapid loss of dsRed and the activation of your gene fused to eGFP expression.DepositorInserteGFP
UseCre/Lox and RetroviralExpressionMammalianAvailable SinceDec. 13, 2011AvailabilityAcademic Institutions and Nonprofits only -
pBBR1MCS-2
Plasmid#85168PurposeMobilisable shuttle and expression vector. Replicates in many Gram-negative bacteria. Has multiple cloning site with blue/white selection function. Cloned genes driven by derepressed lac promoter.DepositorHas ServiceCloning Grade DNATypeEmpty backboneExpressionBacterialPromoterConstitutive (derepressed P-lac)Available SinceNov. 8, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits