We narrowed to 11,871 results for: KIN
-
Plasmid#134265PurposeLentivector encoding Flag-tagged GK5 truncation (amino acids 287-396)DepositorInsertGk5 (Gk5 Mouse)
UseLentiviralTagsFlagExpressionMammalianMutationmouse Gk5 amino acids 287-396PromoterCMVAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL2-HKII-B
Plasmid#64514PurposeAS-30D hepatoma hexokinase II 3.0 kbp promoter-luciferase reporter vectorDepositorInsertType II hexokinase gene, partial cds and promoter region (Hk2 Rat)
UseLuciferaseTagsfirefly luciferaseMutationIsolated from AS-30D rat hepatomaPromoterHexokinase IIAvailable SinceJuly 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
IL2-AHDC2-Cherry in pmCherryN1
Plasmid#187291PurposeExpress pmCherry-IL2-AH-deltaC2DepositorTagsmCherryExpressionMammalianMutationAH-deltaC2PromoterCMVAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
3xFLAG-DGKδ2
Plasmid#226506PurposeExpress N-terminal three tandem FLAG epitope tags, followed by an enterokinase cleavage site and human DGKD geneDepositorInsertDGKD (DGKD Human)
TagsThree tandem FLAG epitope tag and enterokinase cl…ExpressionMammalianPromoterCMVAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVR2
Plasmid#84719PurposeE. coli RecA promoter followed by stretch with no A's followed by riboswitch for single-round transcriptionDepositorInsertsE. coli RecA promoter
stretch lacking A's followed by 5' UTR of queC gene
ExpressionBacterialMutation12 nt stretch lacking A's inserted before 5&…Available SinceMarch 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL2-HKII-F
Plasmid#64518PurposeAS-30D hepatoma hexokinase II 0.075 kbp exon I-luciferase reporter vectorDepositorInsertType II hexokinase gene, partial cds and promoter region (Hk2 Rat)
UseLuciferaseTagsfirefly luciferaseMutationIsolated from AS-30D rat hepatomaPromoterHexokinase II promoter deletedAvailable SinceJune 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-AtRBX1-T7-AtSKP1-T7-AtCUL1-S
Plasmid#238003PurposeExpression AtRBX1-T7, AtSKP1-T7 and AtCUL1-S in in bacterial cellsDepositorTagsS and T7ExpressionBacterialAvailable SinceJune 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBrain-GFP-TACC3KDP∆682-688-shTACC3
Plasmid#69116PurposeDual-promoter plasmid to express knockdown-proof human TACC3 (682-688aa ch-TOG binding site deleted) tagged with EGFP along with shRNA to knock down endogenous TACC3 in mammalian cells.DepositorInsertsUseRNAiTagsEGFPExpressionMammalianMutationDeletion of amino acids 682-688 (region containin…PromoterCMVAvailable SinceOct. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
IL2-mCherry-AHA740D, E758K in pmCherryN1
Plasmid#187285PurposeExpress IL2-AH A740D, E758K-mCherryDepositorTagsmCherryExpressionMammalianMutationAH A740D, E758KPromoterCMVAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
Rev CDK9 (D167N) (P#858)
Plasmid#14635DepositorInsertcdk9 D167N (CDK9 Human)
TagsRevExpressionMammalianMutationD167N. Kinase negative mutant.Available SinceJune 30, 2008AvailabilityAcademic Institutions and Nonprofits only -
pRK5-Myc-PSK2 (K57A)
Plasmid#197118PurposeExpression of kinase-defective MYC-tagged PSK2 (K57A) / TAOK1 (K57A) in mammalian cellsDepositorInsertTAOK1 (K57A) (TAOK1 Human)
TagsMycExpressionMammalianMutationChanged K 57 to APromoterSV40Available SinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/HisMaxB-YAP1-S347A
Plasmid#18993DepositorInsertYes-kinase associated protein S347A mutant (YAP1 Human)
TagsHisExpressionMammalianMutationSerine 347 changed to AlanineAvailable SinceSept. 15, 2008AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
N295A (EcN) MetNIQ in pBAD
Plasmid#118256PurposeN295A Mutation of MetN in Methionine ABC Transporter and Wild Type Methionine Binding Protein for Transport Activity AssayDepositorTags10x HIs Tag, 6x His Tag, and Enterokinase Cleavag…ExpressionBacterialMutationChanged Asparagine (Asn) 295 to Alanine (Ala)PromoterNone and araBAD PromotoerAvailable SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRK5 Myc-tagged PSK (K57A)
Plasmid#197150PurposeExpression of kinase-deficient MYC-tagged PSK1-alpha (K57A) / TAOK2 (K57A) in mammalian cellsDepositorAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
IL2-AH-2A-Cherry-RhoAQ63L in pmCherryN1
Plasmid#187287PurposeExpress pmCherry-IL2-AH-2A-RhoA Q63LDepositorTagsmCherryExpressionMammalianMutationAH-2A-RhoA Q63LPromoterCMVAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
IL2-AHDC2-2A-CherryRhoAQ63L in pmCherryN1
Plasmid#187292PurposeExpress pmCherry-IL2-AH-deltaC2-2A-RhoA Q63LDepositorTagsmCherryExpressionMammalianMutationAH-deltaC2, RhoA Q63LPromoterCMVAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEBG MKK3b (Glu)
Plasmid#50451Purposeactivates p38 in the signaling pathwayDepositorInsertMKK3b (MAP2K3 Human)
TagsGstExpressionMammalianMutationchanged Serine 218 to Glutamic Acid, changed Thre…PromoterSV40Available SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
plIG-109_CD19-BBz_CAR_SR_Library
Pooled Library#207476PurposeCD19-BBz CAR in combination with 129 surface receptors and 2 controls (GFP/RFP). Library can be used to generate HDR templates for modular pooled knockin (ModPoKI) into the TRAC locus of human T cellsDepositorUseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
3xFLAG-DGKδ2-ΔSAMD
Plasmid#226507PurposeExpress N-terminal three tandem FLAG epitope tags, followed by an enterokinase cleavage site and human DGKD gene deleted SAM domainDepositorInsertDGKD (DGKD Human)
TagsThree tandem FLAG epitope tag and enterokinase cl…ExpressionMammalianMutationdeleted sterile alpha motif domain (deleted amino…PromoterCMVAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
IL2-AHA740D, E758K-2A-Cherry-RhoAQ63L in pmCherryN1
Plasmid#187288PurposeExpress pmCherry-IL2-AH A740D, E758K-2A-RhoA Q63LDepositorTagsmCherryExpressionMammalianMutationAH A740D, E758K, RhoA Q63LPromoterCMVAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEBG MKK3b(Glu, delete LXL)
Plasmid#50452Purposeactivates p38 in the signaling pathwayDepositorInsertMKK3b (MAP2K3 Human)
TagsGstExpressionMammalianMutationdeleted L25-I27, changed Serine 218 to Glutamic A…PromoterSV40Available SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
N229A (EcQ) MetNIQ in pBAD
Plasmid#118257PurposeN229A Mutation in Methionine Binding Protein (MetQ) and Wild Type Methionine ABC Transporter for Transport Activity AssayDepositorTags10x HIs Tag, 6x His Tag, and Enterokinase Cleavag…ExpressionBacterialMutationChanged Asparagine (Asn) 229 to Alanine (Ala) and…PromoterNone and araBAD PromoterAvailable SinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
PSOP1-COMP-blac-flag-his
Plasmid#111003PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertsecreted ookinete protein (PSOP1) (PF3D7_0721700 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
PSOP7-COMP-blac-flag-his
Plasmid#110996PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertsecreted ookinete protein, putative (PSOP7) (PF3D7_1340000 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
P28-COMP-blac-flag-his
Plasmid#110990PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertookinete surface protein P28 (PF3D7_1030900 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
PSOP24-COMP-blac-flag-his
Plasmid#110983PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertsecreted ookinete protein (PSOP24) (PF3D7_0108700 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
plIG-128_HA-GD2-28z_CAR_TFxTF_Library
Pooled Library#207480PurposeHA-GD2-28z CAR in combination with ~10,000 transcription factor combinations (and related proteins) and controls (GFP/RFP combinations). Library can be used to generate HDR templates for modular pooleDepositorUseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDF_AtRaf1/Raf2/RbcX2/BSD2/RbcX1
Plasmid#229510PurposeExpresses Arabidopsis thaliana chaperones: Raf1,Raf2,RbcX2,BSD2,RbcX1DepositorInsertsExpressionBacterialMutationN terminus chloroplast transit peptide truncationPromoterT7Available SinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
N295A (EcN), N229A (EcQ) MetNIQ in pBAD
Plasmid#118581PurposeN295A Mutation of MetN in Methionine ABC Transporter and N229A Mutation in Methionine Binding Protein (MetQ) for Transport Activity AssayDepositorTags10x HIs Tag, 6x His Tag, and Enterokinase Cleavag…ExpressionBacterialMutationChanged Asparagine (Asn) 229 to Alanine (Ala) and…PromoterNone and araBAD PromotoerAvailable SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
plIG-123_HA-GD2-28z_CAR_TF_Library
Pooled Library#207478PurposeHA-GD2-28z CAR in combination with 100 transcription factors (and related proteins) and 2 controls (GFP/RFP). Library can be used to generate HDR templates for modular pooled knockin (ModPoKI) into thDepositorSpeciesHomo sapiensUseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
N295A (EcN), Y160A (EcI) MetNIQ in pBAD
Plasmid#118260PurposeN295A Mutation of MetN and Y160A in MetI in Methionine ABC Transporter for Transport Activity AssayDepositorTags10x HIs Tag, 6x His Tag, and Enterokinase Cleavag…ExpressionBacterialMutationChanged Glutamic Acid (Glu) 295 to Alanine (Ala) …PromoterNone and araBAD PromoterAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJTB126
Plasmid#248910Purposeexpresses the yeast analog-sensitive Smk1-Q120A and Ssp2 fused to glutathione-S-transferase in bacteriaDepositorInsertsSMK1 Mitogen-activated Protein Kinase -analog-sensitive form (SMK1 Sequence is from the SK1 isolate of S. cerevisiae and will differ by 1 non-synonomous/several synonymous changes from S288C form, Budding Yeast)
Ssp2 Activator of the Smk1 MAPK (SSP2 Budding Yeast, Sequence is from the SK1 isolate of S. cerevisiae and may differ by synonymous changes from S288C form)
Tagsglutathione-S-transferaseExpressionBacterialMutationcodon 120 has been changed from Q to A (Smk1-Q120…PromoterT7Available SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
RCAS.Sfi Akt1-K179M
Plasmid#196375PurposeAkt1 kinase negative mutant K179M in avian expression vectorDepositorInsertc-akt1 K179M
UseRetroviral; AvianTagsHAAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHALgMT
Plasmid#234792PurposeMammalian expression of yeast OMP25DepositorInsertOMP25
TagsLgBiTExpressionMammalianAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCCI-YFVΔCME-mScarlet
Plasmid#233589PurposepCCI vector encoding YFV-17D lacking C, prM, E but with mScarletDepositorInsertYFV-17D lacking C, prM, E but with mScarlet
UseTransneural tracingMutationLacking C, prM, and EPromoterSP6Available SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
CSII-mApple
Plasmid#207350PurposeMammalian expression of mAppleDepositorInsertmApple
ExpressionMammalianAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAG.mCherry-INBox-eDHFR
Plasmid#176202PurposeSingle INBox (INCENP 819-918) recruitment responsible for targeted Aurora B activation and recruitment using TMP-Halo dimerization systemDepositorInsertmCherry-INBox-eDHFR
ExpressionMammalianAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCCI-YFVΔCMENS1-Flpo
Plasmid#233592PurposepCCI vector encoding YFV-17D lacking C, prM, E and NS1 proteins but with FlpoDepositorInsertYFV-17D lacking C, prM, E and NS1 proteins but with Flpo
UseTransneural tracingMutationLacking C, prM, E and NS1PromoterSP6Available SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV hSyn mRuby
Plasmid#220912PurposeNeuronal specific expression of mRubyDepositorInsertmRuby
UseAAVExpressionMammalianPromoterhSynAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 - TRC mTagBFP2-Synapsin1a
Plasmid#191567PurposeExpresses an shRNA and mTagBFP2-synapsin1aDepositorTypeEmpty backboneUseLentiviral and RNAiExpressionMammalianPromoterU6 for shRNAAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
Unc104_K560GFP
Plasmid#129773PurposeExpresses worm Kinesin-3 Unc104 head and neck linker, dimerized through kinesin-1 neck-coil and coil-1 to 560 and GFP taggedDepositorInsertUnc104 (unc-104 Nematode)
TagsGFP and His6ExpressionBacterialMutationTruncation at 361, fused to kinesin-1 starting Al…Available SinceNov. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28a_Pro-IL-18_sheep
Plasmid#214335PurposeProtein overexpression in bacteriaDepositorInsertIL18
TagsHis-TEV and MycExpressionBacterialPromoterT7Available SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a_Pro-IL-18_rat
Plasmid#214333PurposeProtein overexpression in bacteriaDepositorAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a_Pro-IL-18_rabbit
Plasmid#214334PurposeProtein overexpression in bacteriaDepositorInsertIL18
TagsHis-TEV and MycExpressionBacterialPromoterT7Available SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a_Pro-IL-18_dog
Plasmid#214336PurposeProtein overexpression in bacteriaDepositorInsertIL18
TagsHis-TEVExpressionBacterialPromoterT7Available SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only