We narrowed to 12,288 results for: GFP expression plasmids
-
Plasmid#198210PurposepJL1 plasmid encoding superfolder GFP modified at the C-terminus with 30 amino acids containing an optimal DQNAT sequon followed by a 6x-His tagDepositorInsertsfGFP_DQNAT
Tags6x His Tag and DQNAT glycosylation tagExpressionBacterialPromoterT7Available SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Sst12-GFP
Plasmid#172311PurposeSST interneuron-restricted gene regulatory element GRE12, to drive GFP expression in SST+ interneuronsDepositorInsertSst12
UseAAVPromoterpB-GlobinAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Sst22-GFP
Plasmid#172312PurposeSST interneuron-restricted gene regulatory element GRE22, to drive GFP expression in SST+ interneuronsDepositorInsertSst22
UseAAVPromoterpB-GlobinAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP-GFP-LmnB1
Plasmid#164249Purposeretroviral plasmid for GFP-LmnB1DepositorAvailable SinceMay 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHRdSV40_scFv_GCN4_sfGFP-VPR-GB1_NLS
Plasmid#79373PurposeRecruits VPR to a compatible Cas9 protein for transcriptional activationDepositorInsertGCN4-sfGFP-VPR
UseCRISPRExpressionMammalianAvailable SinceOct. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFAP-Archon-EGFP
Plasmid#187979PurposeExpresses the fluorescent voltage indicator Archon under the GFAP promoterDepositorInsertArchon1-EGFP
UseAAVAvailable SinceAug. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-PTEN C124A
Plasmid#50520PurposeThis plasmid contains GFP21, which has a sequence similar to YFP, but emission/excitation similar to GFP.DepositorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
LLP726_L2_pV01_0I_TMV-tGFP_TCTP-fLUC
Plasmid#192406PurposeTo be a control plasmid that has no Rluc repression (replaced by turboGFP) and should reflect true off state of the circuit.DepositorInsertAct2::Turbo GFP
UseSynthetic BiologyTagsN7ExpressionPlantAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGFP-PTEN D92A
Plasmid#50521PurposeThis plasmid contains GFP21, which has a sequence similar to YFP, but emission/excitation similar to GFP.DepositorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-D134*
Plasmid#191110PurposeAn E. coli sfGFP reporter with one TAG at position 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-V2*D134*
Plasmid#191111PurposeAn E. coli sfGFP reporter with two TAG at positions 2 & 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging V2 & D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
ΔCT163-GFP
Plasmid#33116DepositorInsertPcdh-γA3 (Pcdhga3 Mouse)
TagsEGFPExpressionMammalianMutationDeletion of the last 163 aa of the variable cytop…PromoterCMVAvailable SinceOct. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
rAAV-syn::FLEX-rev::PSAML141F,Y115F:5HT3HC-IRES-GFP
Plasmid#32477PurposeCre-dependent expression of PSAM-5HT3 HC (L141F,Y115F) neuronal activator, with IRES-EGFP markerDepositorInsertPSAML141F,Y115F-5HT3HC
UseAAV and Cre/Lox; Adeno-associated virus, flex swi…TagsIRES-EGFPPromoterSynapsinAvailable SinceJan. 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
rAAV-syn::FLEX-rev::PSAMQ79G,Q139G:5HT3HC-IRES-GFP
Plasmid#32475PurposeCre-dependent expression of PSAM-5HT3 HC (Q79G,Q139G) neuronal activator, with IRES-EGFP markerDepositorInsertPSAMQ79G,Q139G-5HT3HC
UseAAV and Cre/Lox; Adeno-associated virus, flex swi…TagsIRES-EGFPPromoterSynapsinAvailable SinceDec. 12, 2011AvailabilityAcademic Institutions and Nonprofits only -
PAC_E83_LOV_eGFP
Plasmid#231574PurposeThis plasmid mediates puromycin resistance in the dark, resulting in puro mediated cell death upon illumination with blue lightDepositorInsertPAC-P2A-GFP carrying an insertion of AsLOV2 behind E83
ExpressionMammalianAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
114_UBI_iCre_crystGFP
Plasmid#171797PurposeTol2-plasmid ubiquitously expressing iCre (ubiquitin promoter) along with eGFP selection marker (Crystallin promoter -Lens/Eyes-)DepositorInsertoptimised iCre under the control of the Ubiquitin promoter
PromoterUbiquitinAvailable SinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits only