We narrowed to 80,357 results for: TRI
-
Plasmid#123332PurposeGreen-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity.DepositorInsertGFP-GFP-FLARE-AKAR
UseTags6xHIS, EGFP, T7 tag (gene 10 leader), and Xpress …ExpressionMammalianMutationPromoterCMVAvailable sinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEMS2044
Plasmid#79652PurposessAAV genome with Ple255 (PAX6 MiniPromoter) driving an emerald GFP (EmGFP) reporter. Contains WPREDepositorInsertssAAV Ple255-EmGFP WPRE
UseAAVTagsExpressionMutationPromoterPAX6 HS234Z EnhancerAvailable sinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCS3-MT-BX/ARF1-64
Plasmid#78762PurposeTo overexpress ARF1-64 in Mammalian CellsDepositorInsertARF (CDKN2A Human)
UseTags6xMYCExpressionMammalianMutation1-64PromoterCMV IE94Available sinceJune 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCS3-MT-BX/ARF65-132
Plasmid#78763PurposeTo overexpress ARF65-132 in Mammalian CellsDepositorInsertARF (CDKN2A Human)
UseTags6xMYCExpressionMammalianMutation65-132PromoterCMV IE94Available sinceJune 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-SwitchON-sgCh2-2
Plasmid#199637PurposeTamoxifen-inducible expression of sgRNA control targeting intergenic regionDepositorInsertN/A
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJune 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
HH06-LP Clone 6 heavy chain
Plasmid#192176PurposeClone 6 heavy chain (HH06)DepositorInsertClone 6 heavy chain (HH06)
UseTagsExpressionMammalianMutationNAPromoterAvailable sinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1-INTS3-N
Plasmid#128416PurposeExpress INTS3 N-termini (1-513 aa) in E. coli with a GST tag (N-terminal)DepositorInsertINTS3 (INTS3 Human)
UseTagsGSTExpressionBacterialMutationN-terminal region (1–513 aa)Promotertac promoterAvailable sinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
p221- purVSG117UTR
Plasmid#59732PurposeInserts a puromycin resistance gene and a VSG117 gene into the VSG221 expression site of T.brucei downstream of the expression site promoter.DepositorInsertVSG117 flanked upstream and downstream by sequences homologous to the VSG221 expression site
UseFor homologous recombination into vsg221 expressi…TagsExpressionMutationPromoterAvailable sinceAug. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
HOXB4 (human) HA-TAT-tag pET
Plasmid#8526DepositorInsertHOXB4 (HOXB4 Human)
UseTagsHAExpressionBacterialMutationreplace T7 and HIS tags of pET with an HA tag;PromoterAvailable sinceMay 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-Hook2
Plasmid#198524PurposeExpression of GAL4 DNA-binding domain (BD)-Hook2 fusion protein in yeast (yeast two-hybrid assays)DepositorInsertHook2 (HOOK2 Human)
UseTagsGAL4-DNA binding domain fragmentExpressionYeastMutationHis488Gln substitutionPromoterADH1Available sinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisTagsExpressionMutationPromoterAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ oDam_f_GFPoNLS
Plasmid#85819PurposeiDamID plasmid. To express transiently the optimized E. coli Dam adenine methyltransferase fused to the nuclear-localized mmGFP via flexylinker.DepositorInsertoDam_f_GFPoNLS
UseTagsoNLS (optimized nuclear localization signal) C te…ExpressionBacterial, Insect, Mammalia…MutationL122A. Codon optimization compatible to work in M…PromoterAvailable sinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPKm-245
Plasmid#90503PurposeExpresses HO1, PCYA, FD and FNR, required for PCB synthesis. pSIN - EF-1alpha - MTS - tHO1 - P2A - MTS - tPCYA - P2A - MTS - tFD - P2A - MTS - tFNRDepositorInsertmito-tHO1, mito-tPCYA, mito-tFD, mito-tFNR
UseLentiviralTagsExpressionMutationPromoterAvailable sinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPKm-244
Plasmid#90502PurposeExpresses HO1, PCYA, FD and FNR, required for PCB synthesis. pSIN - EF-1alpha - MTS - tHO1 - P2A - MTS - tPCYA - IRES - MTS - tFD - P2A - MTS - tFNRDepositorInsertmito-tHO1, mito-tPCYA, mito-tFD, mito-tFNR
UseLentiviralTagsExpressionMutationPromoterAvailable sinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pQC hKGA.wt V5-His IRES G418
Plasmid#110390PurposeÎł-Retroviral transfer vector for expressing glutminase isoform KGA (wild type), C-terminal V5-6xHis tags, IRES-driven Geneticin selection.DepositorInsertKGA glutaminase (GLS Human)
UseRetroviralTags6xHis and V5ExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBS-Squ5'3'
Plasmid#20165DepositorInsertspaghetti squash (squ, myosin II RLC) 5' UTR, ORF (without stop codon) and 3' UTR with multiple cloning site downstream (sqh Fly)
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 N. meningitidis sgRNA BfuAI large stuffer
Plasmid#86195PurposeU6 based expression of N meningitidis sgRNADepositorInsertnmCas9 sgRNA cloning cassete
UseLentiviralTagsExpressionMutationPromoterU6Available sinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pmiR-96 cluster promoter
Plasmid#62517PurposemicroRNA 183-96-182 cluster promoter luciferase plasmidDepositorInsertpromoter of microRNA-183-96-182 cluster
UseTagsRenSP (optimized renilla luciferase gene)ExpressionMammalianMutationPromoterAvailable sinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPKm-112
Plasmid#90494PurposepcDNA3 - pCMV - MTAD - PIF3, expresses Phytochrome interacting factor 3 (PIF3) and minimal transactivation domain (MTAD), under CMV promoterDepositorInsertMTAD-PIF3
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Venus-Venus-FLARE-AKAR
Plasmid#123331PurposeYellow-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity.DepositorInsertVenus-Venus-FLARE-AKAR
UseTags6xHIS, T7 tag (gene 10 leader), Venus, and Xpress…ExpressionMammalianMutationPromoterCMVAvailable sinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO.1 PURO shId2 #2
Plasmid#83090PurposeLentiviral shRNA vector for inducible knockdown of mouse Id2DepositorInsertshId2 (Id2 Mouse)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
pLenti-sgCCR5
Plasmid#83930PurposeLentiviral vector expressing an sgRNA targeting CCR5 NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgCCR5
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBABE hygro MEN1 L22R
Plasmid#11021DepositorInsertMEN1 L22R (MEN1 Human)
UseRetroviralTagsExpressionMammalianMutationL22RPromoterAvailable sinceDec. 2, 2005AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Cerulean3-Cerulean3-FLARE-EKAR-EV
Plasmid#123342PurposeCyan-fluorescent homoFRET/anisotropy-based biosensor for monitoring ERK activity.DepositorInsertCerulean3-Cerulean3-FLARE-EKAR-EV
UseTags6xHIS, Cerulean3, T7 tag (gene 10 leader), and Xp…ExpressionMammalianMutationPromoterCMVAvailable sinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFLAG-4S Tetherin
Plasmid#41073DepositorInsertTetherin (BST2 Human)
UseTagsFLAGExpressionMammalianMutationS74, S84, 137S, and 144SPromoterCMVAvailable sinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_FOXM1_iso1
Plasmid#135734PurposeDonor vector for 3' FLAG tag of human FOXM1_iso1DepositorInsertFOXM1_iso1 Homology arms (FOXM1 Human)
UseCRISPRTags3XFLAG-P2A-NeoRExpressionMutationPromoterAvailable sinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEMS2049
Plasmid#79657PurposessAAV genome with Ple260 (PAX6 MiniPromoter) driving an emerald GFP (EmGFP) reporter. Contains WPREDepositorInsertssAAV Ple260-EmGFP WPRE
UseAAVTagsExpressionMutationPromoterPAX6 Retinal EnhancerAvailable sinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFLAG-137.144S Tetherin
Plasmid#41072DepositorInsertTetherin (BST2 Human)
UseTagsFLAGExpressionMammalianMutation137S, 144SPromoterCMVAvailable sinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only