We narrowed to 8,902 results for: tre promoter
-
Plasmid#52255PurposeCan use a PCR template to assemble new desired guide RNA. Contains an Arabidopsis U6 promoter to drive guide RNA (targeting AtPDS3 gene target site 1) expression with a TTTTTT as terminator.DepositorInsertguide RNA targeting AtPDS3 (PDS3 Mustard Weed)
UseCRISPR; Plant expressionTagsExpressionMutationPromoterArabidopsis U6 polymerase III promoterAvailable sinceMarch 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EF1a-MICB*005-IRES-ZsGreen
Plasmid#114008PurposeInduces expression of human MICB allele 005 cDNADepositorInsertMICB*005 (MICB Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EF1a MICA*009-IRES-ZsGreen
Plasmid#114007PurposeInduces expression of human MICA allele 009 cDNADepositorInsertMICA*009 (MICA Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Sec22b-P33-shR
Plasmid#208359PurposeMammalian expression of fluorescent N-terminally tagged shRNA resistant Sec22b-P33 mutantDepositorInsertSec22b (Sec22b Rat)
UseTagsEGFPExpressionMammalianMutationfour silent mutations (shRNA resistance), 33 aa p…PromoterCMVAvailable sinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET41-FeoB-OL2del
Plasmid#216742PurposeStudy the interaction of FeoB in P. aeruginosa, specifically focusing on the role of the outer loop 2 (OL2) by examining the variant lacking OL2 in its interaction with exogenous peptides.DepositorInsertfeoB (PA4358 P. aeruginosa (Bacteria))
UseTags8x HisExpressionBacterialMutationOuter loop 2 (OL2) with the sequence of [LEDSGYMA…PromoterAvailable sinceSept. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET41-FeoB-OL4del
Plasmid#216744PurposeStudy the interaction of FeoB in P. aeruginosa, specifically focusing on the role of the outer loop 4 (OL4) by examining the variant lacking OL4 in its interaction with exogenous peptides.DepositorInsertfeoB (PA4358 P. aeruginosa (Bacteria))
UseTags8x HisExpressionBacterialMutationOuter loop 4 (OL4) with the sequence of [TLDGKPVQ…PromoterAvailable sinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET41-FeoB-OL5del
Plasmid#216745PurposeStudy the interaction of FeoB in P. aeruginosa, specifically focusing on the role of the outer loop 5 (OL5) by examining the variant lacking OL5 in its interaction with exogenous peptides.DepositorInsertfeoB (PA4358 P. aeruginosa (Bacteria))
UseTags8x HisExpressionBacterialMutationOuter loop 5 (OL5) with the sequence of [ATFAA] i…PromoterAvailable sinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET41-FeoB-OL1del
Plasmid#216741PurposeStudy the interaction of FeoB in P. aeruginosa, specifically focusing on the role of the outer loop 1 (OL1) by examining the variant lacking OL1 in its interaction with exogenous peptides.DepositorInsertfeoB (PA4358 P. aeruginosa (Bacteria))
UseTags8x HisExpressionBacterialMutationOuter loop 1 (OL1) with the sequence of [INIGGALQ…PromoterAvailable sinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUN1213 - pL0_p16OMT (pro + 5U)
Plasmid#203890Purpose16OMT promoter and native 5'UTR (approximately 1 kb upstream of start codon) from C. roseus in a MoClo compatible L0 plasmid.DepositorInsert16OMT promoter and 5'UTR
UseTagsExpressionPlantMutationMutation of BpiI and/or BsaI cut sites for MoClo …PromoterAvailable sinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUN1214 - pL0_pNMT (pro + 5U)
Plasmid#203893PurposeNMT promoter and native 5'UTR (approximately 1 kb upstream of start codon) from C. roseus in a MoClo compatible L0 plasmid.DepositorInsertNMT promoter and 5'UTR
UseTagsExpressionPlantMutationMutation of BpiI and/or BsaI cut sites for MoClo …PromoterAvailable sinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-safb∆sap-NLS-3XFLAG-V5
Plasmid#196091PurposeExpresses mouse SAFB lacking the n-terminal SAP domain in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
UseTagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationRemoved amino acids 31-65 (SAP domain) of mouse S…PromoterCAGGSAvailable sinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-safb∆rrm-NLS-3XFLAG-V5
Plasmid#196093PurposeExpresses mouse SAFB lacking the rrm domain in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
UseTagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationRemoved amino acids 428-506 (RRM) of mouse SAFB p…PromoterCAGGSAvailable sinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CAG-NOTCH2NL-delta C terminus (N2NL-delta C)-ires-mCherry
Plasmid#122959PurposeLentiviral expression of NOTCH2NL delta C terminus under CAG promoter with mCherry expressionDepositorInsertNOTCH2NL-delta C terminus (NOTCH2NLB Human)
UseLentiviralTags6xmyc tagExpressionMutationdeletion of C terminus from full length NOTCH2NLBPromoterCAG promoterAvailable sinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CAG-NOTCH2NL-delta C terminus (N2NL-delta C)-ires-EGFP
Plasmid#122956PurposeLentiviral expression of NOTCH2NL delta C terminus under CAG promoter with EGFP expressionDepositorInsertNOTCH2NL-delta C terminus (NOTCH2NLB Human)
UseLentiviralTags6xhis tagExpressionMutationdeletion of C terminus from full length NOTCH2NLBPromoterCAG promoterAvailable sinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-safb∆dd1-NLS-3XFLAG-V5
Plasmid#196092PurposeExpresses mouse SAFB lacking the first computationally called disordered domain in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
UseTagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationRemoved amino acids 96-285 (predicted disordered …PromoterCAGGSAvailable sinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-safb∆dd3-NLS-3XFLAG-V5
Plasmid#196094PurposeExpresses mouse SAFB lacking the third computationally called disordered domain in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
UseTagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationRemoved amino acids 638-925 (predicted disordered…PromoterCAGGSAvailable sinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-SAFB-DD3-NLS-3XFLAG-V5
Plasmid#196095PurposeExpresses only the third computationally called disordered domain of mouse SAFB in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
UseTagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationContains only AA 619-925 (NLS and predicted disor…PromoterCAGGSAvailable sinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIVTR(T7A)-ATOH1 (SA Substitutions)
Plasmid#172309PurposeIn vitro transcription of ATOH1 (Ser phosphosites substituted by Ala)DepositorInsertATOH1 (ATOH1 Human)
UseOtherTagsExpressionMutationS331A, S342APromoterT7 promoter A-initiatingAvailable sinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only