We narrowed to 6,896 results for: tet
-
Plasmid#211733PurposeExpresses tetracysteine tagged VDAC1 in mammalian cells. TC-tag is attached to the C-terminus of VDAC1.DepositorInsertVoltage-dependent anion channel 1 (VDAC1 )
TagsTetracysteineExpressionMammalianPromoterCMVAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAR357_SFP_pCDF-1b
Plasmid#122851PurposeCo-expresses the phosphopantheteine transferase Sfp of Bacillus subtilis to transfer a PPant arm to acyl carrier proteins in Escherichia coli. Untagged; in pCDF-1b vector.DepositorInsertSfp
ExpressionBacterialPromoterT7 promoterAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAraH6HATT
Plasmid#63901PurposeFor expression of soluble scFv/Fab fragments in bacteria from genes selected using the pComb3H system, contains TT Fab (light and heavy chains) against tetanus toxin, used as expression control.DepositorInsertTT Fab
Tags6xHis and HA tagExpressionBacterialPromoteraraBADAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
integrin alpha9 / alpha4 pcDNA1 neo
Plasmid#13587DepositorInsertintegrin alpha 9 / alpha 4 (ITGA9 Human)
ExpressionMammalianMutationIntegrin alpha 9 chimera containing the cytoplasm…Available SinceJan. 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
integrin alpha9 / alpha5 pcDNA1 neo
Plasmid#13588DepositorInsertintegrin alpha 9 / alpha 5 (ITGA9 Human)
ExpressionMammalianMutationIntegrin alpha 9 chimera containing the cytoplasm…Available SinceJan. 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
Reckleen_2_SpGCas9
Plasmid#233457PurposeLevel 2 RECKLEEN plasmid, genome editing of Klebsiella pneumoniaeDepositorInsertLevel 2 RECKLEEN plasmid
UseCRISPRAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
PABPC1
Plasmid#155805PurposeFor use in RBP tethering screenDepositorAvailable SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMycDam
Plasmid#59218PurposeDrosophila DamID vector used to fuse gene of interest to Myc-tagged E.coli DamDepositorTypeEmpty backboneUseDamidTagsDam and MycExpressionInsectPromoterDrosophila heat-shock promoterAvailable SinceMay 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-bio-myc-NES-EGFP
Plasmid#112712PurposeFor tetracycline-inducible expression of bio-myc-NES-EGFP in mammalian cellsDepositorInsertEGFP
TagsHIV Rev nuclear localization signal (NES), biotin…ExpressionMammalianMutationNucleotide sequence optimized for synthetic gene …PromoterCMV with Tet repressor binding sitesAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
SQ171fg/pCSacB
Plasmid#69344PurposeSQ171 fast growing strain supported by pCSacB plasmidDepositorInsertpCSacB
Available SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
poRibo-T2
Plasmid#69347PurposeRibo-T with orthogonal anti-Shine-Dalgarno sequence, and pL G to T mutationDepositorInsertoRibo-T
ExpressionBacterialAvailable SinceOct. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC33
Plasmid#62330PurposesgRNA + 2x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pNL-EGFP/TREPittdU3
Plasmid#18659DepositorInsertEGFP
UseLentiviralAvailable SinceJuly 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCph8
Plasmid#22869DepositorInsertpCph8
UseSynthetic BiologyExpressionBacterialMutationFirst 517 amino acids of Cph1 and the last 229 am…Available SinceJune 21, 2010AvailabilityAcademic Institutions and Nonprofits only -
pEN12A-P1
Plasmid#27366DepositorInsertPmyc1tetO
UseGateway CloningExpressionBacterialMutationN/AAvailable SinceMay 17, 2011AvailabilityAcademic Institutions and Nonprofits only -
pHTIKA
Plasmid#22062DepositorInserthCMV-TetOn expression cassette
ExpressionMammalianAvailable SinceOct. 21, 2009AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ Myc2-mouse TTP WT
Plasmid#107000PurposeExpresses epitope-tagged wild-type murine TTPDepositorAvailable SinceMarch 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TIWB-yellow pre-eGRASP(p30)
Plasmid#111588PurposeAn AAV vector that expresses yellow pre-eGRASP(p30) under the tetO promoter.DepositorInsertyellow pre-eGRASP(p30)
UseAAVPromotertetOAvailable SinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
FRP2372
Plasmid#127578PurposeRepressor plasmid for WTC 846. Encodes TetR and TetR-Tup1, Lys2 selection markerDepositorInsertPRnr2_TetR-NLS-TUP1_tCyc1_PtetO7.1_TetR-NLS_tCyc1
UseSynthetic Biology; Shuttle vectorExpressionYeastAvailable SinceAug. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOSIP-KH-RBS2-dCas9
Plasmid#182740PurposeIntegrative plasmid at the HK022 site in E. coli carrying dCas9 under the control of a Ptet promoterDepositorInsertdCas9
UseCRISPR; Integrative vectorPromoterPtetAvailable SinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only