We narrowed to 895 results for: gcat
-
Plasmid#101154PurposegRNA with 16 MCP binding siteDepositorInsertMUC4 (MUC4 Human)
UseCRISPR and LentiviralAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-sh-hSOX9-1
Plasmid#40644DepositorAvailable SinceSept. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
Musunuru-Cowan TALEN Kit
Plasmid Kit#1000000034PurposeThis collection allows the efficient assembly of TALEN constructs with custom repeat arrays, each containing 15 repeats for expression in mammalian cells.DepositorApplicationGenome EditingVector TypeMammalian ExpressionEditing TypeTALENAvailable SinceJuly 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
Sg-A
Plasmid#83807PurposeExpress sgRNA targeting SA siteDepositorInsertSgRNA
UseCRISPRAvailable SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
TBP6.7 non-targeting gRNA lambda phage
Plasmid#132547Purposeexpresses gRNA for TBP-based CIRTSDepositorInsertgRNA TBP-based CIRTS
ExpressionMammalianPromoterhU6 promoterAvailable SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXL002-ishRNA-beta-catenin-1
Plasmid#36297DepositorInsertshRNA of beta-catenin-1 (CTNNB1 Human)
UseLentiviral and RNAiTagsIRES-RFP-PuroExpressionMammalianPromoterTetO-H1Available SinceAug. 7, 2012AvailabilityAcademic Institutions and Nonprofits only -
pU6-PspCas13b-gRNA-Actb1216
Plasmid#155368PurposePspCas13b guide RNA positioned 8bp 5' of Actb 1216 for targeted m6A RNA methylationDepositorInsertPspCas13b gRNA targeting Actb 1216
UseCRISPRExpressionMammalianAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRyl_A08
Plasmid#84610PurposeIntroduces DSB at A08 locus in Y. lipolyticaDepositorInsertCas9
UseCRISPR and Synthetic BiologyExpressionYeastPromoterUAS1B8-TEF(136)Available SinceDec. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCF806-shRen.713
Plasmid#186712PurposeExpresses dox-controlled miR-E shRNAs (UT4GEPIR). Non-targeting control shRNA (shRen.713).DepositorInsertshRen.713
UseLentiviral and RNAiExpressionMammalianAvailable SinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pC0051-W85X REPAIR targeting guide cloned into pC0043
Plasmid#103867PurposeGuide RNA expression plasmid for dPspCas13b that can be used to direct ADAR deaminase domain activity to the W85X mutation in the luciferase reporter plasmid pC0038DepositorInsertW85X targeting guide RNA
UseCRISPRExpressionMammalianAvailable SinceNov. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUCsRNAP
Plasmid#182746PurposeSwapping in small RNA promoter, 23-bp spacer sequence, & 19-bp repeats into pJC005 plasmidsDepositorInsertsmall RNA promoter, a 23-bp spacer sequence, & 19-bp repeats
UseCRISPRAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUDP082
Plasmid#103875PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Kluyveromyces marxianusDepositorInsertHH-gRNA-HDV targetting ADE2 in Kluyveromyces marxianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP025
Plasmid#103874PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Kluyveromyces lactisDepositorInsertHH-gRNA-HDV targetting ADE2 in Kluyveromyces lactis
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
Cas9-GFP_sg_mAMPKa1
Plasmid#79004PurposeExpresses WT Cas9 and GFP, along with a sgRNA to mouse AMPK alpha 1.DepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUDP013
Plasmid#103873PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Ogataea (para)polymorphaDepositorInsertHH-gRNA-HDV targetting ADE2 in Ogataea (para)polymorpha
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC57-CmYLCV
Plasmid#205245PurposeFor plant prime editing in wheat plants or monocotyledons protoplastsDepositorInsertCmYLCV-csy4_binding_site-esgRNA-tevopreQ1-csy4_binding_site
UseCRISPRExpressionPlantPromoterCmYLCVAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgLKB1 clone1
Plasmid#162125PurposeLentiviral sgRNA plasmid targeting human LKB1DepositorInsertsgLKB1 (STK11 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUDP044
Plasmid#101168PurposepUDP004 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes SeATF1 and SeATF2 and Spcas9D147Y P411T in S. pastorianus (HH-gRNASeATF1-HDV-linker-HH-gRNASeATF2-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting SeATF1 and 2 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
TMPRSS2 g1 + Cas9
Plasmid#153015PurposeA guide RNA targeting TMPRSS2 in a lentiviral plasmid co-expressing Cas9 and TagBFP2DepositorInsertCas9 + TMPRSS2 gRNA
UseCRISPR and LentiviralTagsTagBFP2Available SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only