We narrowed to 885 results for: gcat
-
Plasmid#170120PurposeAAV vector carrying a guide RNA targeting the human GAPDH mRNADepositorAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only
-
Circular 200,100 with interspersed loops (GAPDH)
Plasmid#180183PurposeAAV vector carrying a guide RNA targeting the human GAPDH mRNADepositorInsertCircular 200,100 guide RNA with interspersed loops (GAPDH Human)
UseAAVExpressionMammalianPromoterHuman U6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 with 8 bp bulge loops (GAPDH)
Plasmid#170121PurposeAAV vector carrying a guide RNA targeting the human GAPDH mRNADepositorInsertCircular 200,100 guide RNA with 8bp bulge loops (GAPDH Human)
UseAAVExpressionMammalianPromoterHuman U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode19
Plasmid#226196PurposeExpression mappingDepositorInsertSyn Barcode19
UseAAVAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
TMPRSS2 g1 + Cas9
Plasmid#153015PurposeA guide RNA targeting TMPRSS2 in a lentiviral plasmid co-expressing Cas9 and TagBFP2DepositorInsertCas9 + TMPRSS2 gRNA
UseCRISPR and LentiviralTagsTagBFP2Available SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pALPS puro miR30-IRF1
Plasmid#117156PurposeTarget site TTGCTCTTAGCATCTCGGCTGDepositorInsertshRNA targeting miR30
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
YN2_1_IL50_HOlocus
Plasmid#194426PurposeExpresses Cas9 and sgRNA cassettes for targeting the HO locus in yeast Saccharomyces cerevisiaeDepositorInsertCas9
ExpressionYeastMutationNAAvailable SinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-RedO-shHsp90ab1 (#a)
Plasmid#206357PurposeAAV plasmid expressing HSP90AB1 shRNA in photoreceptorsDepositorInsertshRNA #a of Hsp90ab1
UseAAVPromoterhuman red opsinAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
OA-1050I (notch)
Plasmid#132421Purposeexpress arrays of gRNA targeting Notch under dU6-3 promoterDepositorInsertnotch gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050U (cinnabar)
Plasmid#132423Purposeexpress arrays of gRNA targeting Cinnabar under dU6-3 promoterDepositorInsertcinnabar gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
TBP6.7 non-targeting gRNA lambda phage
Plasmid#132547Purposeexpresses gRNA for TBP-based CIRTSDepositorInsertgRNA TBP-based CIRTS
ExpressionMammalianPromoterhU6 promoterAvailable SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCA28-pMa-PspCas13b crRNA-TS1
Plasmid#199459PurposeU6-driven crRNA targeting TS1 sequence (CCTCCTCGGAGAGCATCGGTGC )DepositorInsertTS1 crRNA
UseCRISPRPromotermouse U6Available SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003_sgTFAP4 guide 2
Plasmid#193587PurposeTFAP4 knockoutDepositorInsertsgTFAP4 guide 2 (TFAP4 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-DogTag Loop A
Plasmid#171779PurposeExpresses in bacterial cytoplasm superfolder GFP with DogTag and flanking linkers between Val22 and Asn23DepositorInsertsfGFP-DogTag Loop A
TagsHis6ExpressionBacterialMutationDogTag and linkers inserted between residues Val2…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-DogTag Loop B
Plasmid#171780PurposeExpresses in bacterial cytoplasm superfolder GFP with DogTag and flanking linkers between Asp102 and Asp103DepositorInsertsfGFP-DogTag Loop B
TagsHis6ExpressionBacterialMutationDogTag and linkers inserted between residues Asp1…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-SpyTag003 Loop A
Plasmid#171776PurposeExpresses in bacterial cytoplasm superfolder GFP with SpyTag003 and flanking linkers between Val22 and Asn23DepositorInsertsfGFP-SpyTag003 Loop A
TagsHis6ExpressionBacterialMutationSpyTag003 and linkers inserted between residues V…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-DogTag Loop C
Plasmid#171781PurposeExpresses in bacterial cytoplasm superfolder GFP with DogTag and flanking linkers between Asp173 and Gly174DepositorInsertsfGFP-DogTag Loop C
TagsHis6ExpressionBacterialMutationDogTag and linkers inserted between residues Asp1…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-SpyTag003 Loop B
Plasmid#171777PurposeExpresses in bacterial cytoplasm superfolder GFP with SpyTag003 and flanking linkers between Asp102 and Asp103DepositorInsertsfGFP-SpyTag003 Loop B
TagsHis6ExpressionBacterialMutationSpyTag003 and linkers inserted between residues A…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only