We narrowed to 61,377 results for: promoter
-
Plasmid#115798Purposelentiviral, trimethoprim (TMP) regulated YAP promoter activity reporterDepositorAvailable SinceOct. 1, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pGL2-356bp
Plasmid#16292DepositorInsertp53 promoter fragment (TP53 Human)
UseLuciferaseExpressionMammalianMutationfragment -344 to +12 relative to first transcript…Available SinceDec. 14, 2007AvailabilityAcademic Institutions and Nonprofits only -
pEGFP1-sox17 promoter
Plasmid#31400DepositorAvailable SinceOct. 21, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN
Plasmid#11160PurposeMammalian expression vector for cloning and expressing your gene under the CAG promoterDepositorHas ServiceCloning Grade DNAInsertmodified multiple cloning sites
ExpressionMammalianAvailable SinceApril 13, 2006AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Parkin
Plasmid#23956PurposeMammalian expression of human Park2 fused to mCherryDepositorAvailable SinceMarch 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
pTriEx-HTNC
Plasmid#13763PurposeFor expression and purification of a His-TAT-NLS-Cre fusion; HIV-TAT promotes cellular uptake of recombinant Cre into mammalian cells.DepositorInsertHis-TAT-NLS-Cre
UseBaculovirusTagsHis Tag, NLS, and TATExpressionBacterialPromoterp10 promoterAvailable SinceApril 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TREtight-mTagBFP2-B19G (AAV1)
Viral Prep#100799-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-TREtight-mTagBFP2-B19G (#100799). In addition to the viral particles, you will also receive purified pAAV-TREtight-mTagBFP2-B19G plasmid DNA. Helper virus for monosynaptic tracing with rabies virus; to be coinjected with pAAV-syn-FLEX-splitTVA-EGFP-tTA (Addgene# 100798). These AAV preparations are suitable purity for injection into animals.DepositorPromoterTREtightTagsBFP (in presence of Cre and 100798)Available SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
Flag-HA-USP50
Plasmid#22588DepositorAvailable SinceDec. 4, 2009AvailabilityAcademic Institutions and Nonprofits only -
phU6-gRNA
Plasmid#53188PurposeExpresses the S. pyogenes sgRNA from the human U6 promoterDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRExpressionMammalianPromoterhuman U6Available SinceJune 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
3xFLAG-dCas9/pMXs-puro
Plasmid#51240PurposeExpresses 3xFLAG-dCas9 in mammalian cells for enChIP analysis to purify specific genomic regions of interest.DepositorInsert3xFLAG-dCas9
UseCRISPR and RetroviralTags3xFLAG tag and NLS (nuclear localization signal)ExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterLTRAvailable SinceAug. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
M-NM-sgRNA
Plasmid#48673PurposeMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
TRE-KRAB-dCas9-IRES-GFP
Plasmid#85556Purpose2nd generation lentiviral vector expressing a KRAB-dCas9 fusion protein and GFPDepositorInsertKRAB-dCas9-IRES-GFP
UseCRISPR and LentiviralTags2x NLS, HA Tag, and KRAB domainExpressionMammalianPromoterTRE3GAvailable SinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
Flag-HA-USP43
Plasmid#22583DepositorInsertUSP43 (USP43 Human)
UseRetroviralTagsFLAG and HAExpressionMammalianMutationnot FL, missing first 108 aaAvailable SinceNov. 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-hM4D(Gi)-mCherry
Plasmid#50461PurposeDouble floxed Gi-coupled hM4D DREADD fused with mCherry under the control of EF1a promoterDepositorInserthM4D(Gi)-mCherry (CHRM4 Human)
UseAAVTagsHA and mCherryMutationSee supplemental documents for DREADD mutationsPromoterEF1aAvailable SinceApril 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHAGE_puro
Plasmid#118692PurposeEmpty vector to express overexpression cDNADepositorTypeEmpty backboneUseLentiviralPromoterCMVAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHR-SFFV-dCas9-BFP-KRAB
Plasmid#46911PurposeHuman expression vector containing SFFV promoter, dCas9 that is fused to 2x NLS, tagBFP and a KRAB domainDepositorInsertdCas9-BFP-KRAB fusion
UseCRISPR and LentiviralTags2xNLS, BFP, HA, and KRAB domainExpressionMammalianPromoterSFFVAvailable SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-mCherry-H1-(BamHI)
Plasmid#64217PurposeExpression vector for sgRNAs cloned into the BbsI sites, shRNAs into BamHI & AflII and for Expression of Cas9 linked to mCherry via T2ADepositorInsertsCas9
hU6 promoter; BbsI sites for sgRNA
H1 promoter; BamHI site for shRNA
UseCRISPRTags3xFLAG, NLS, and T2A-mCherryExpressionMammalianPromoterCBh, H1, and U6Available SinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
TRE-KRAB-dCas9-IRES-BFP
Plasmid#85449PurposeLentiviral vector expressing a KRAB-dCas9 fusion protein and BFPDepositorInsertKRAB-dCas9-IRES-BFP
UseCRISPR and LentiviralTags2x NLS, HA Tag, and KRAB domainExpressionMammalianPromoterTRE3GAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV GFP Hygro (656-4)
Plasmid#17446Purpose3rd gen lentiviral eGFP expression vector, CMV promoter, HygroDepositorHas ServiceLentiviral PrepInsertGFP
UseLentiviralExpressionMammalianAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
TLCV2
Plasmid#87360PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system. The addition of doxycycline induces Cas9-2A-eGFP. The U6 promoter drives constitutive sgRNA expression.DepositorHas ServiceCloning Grade DNAInsertCas9-2A-eGFP
UseCRISPR and Lentiviral; Doxycycline inducible; egf…TagsCas9-T2A-eGFPExpressionMammalianPromoterTight TRE promoterAvailable SinceFeb. 24, 2017AvailabilityAcademic Institutions and Nonprofits only