We narrowed to 7,962 results for: sms
-
Plasmid#167350PurposeddPCR gating control for droplets containing the env targetDepositorInsertenv
UseOtherAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
Seattle_IPDA_control_32_007
Plasmid#167353PurposeddPCR gating control for droplets containing 5'pol or 3'pol targetsDepositorInsertpol
UseOtherAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
Seattle_IPDA_control_17_005
Plasmid#167351PurposeddPCR gating control for droplets containing gat and tat targetsDepositorInsertgat_tat
UseOtherAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti_EF1a_Flag_TP53_R248W+P278A
Plasmid#183115PurposeExpresses flag-tagged p53 with both R248W and P278A mutations in mammalian cellsDepositorInsertTP53 (TP53 Human)
UseCRISPR and LentiviralTagsFLAGExpressionMammalianMutationchanged proline 278 to alanine and arginine 248 t…PromoterEF1aAvailable SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hADAR1_2g)-PGKpuro2ABFP-W
Plasmid#208434PurposeLentiviral gRNA plasmid targeting human ADAR1 gene, co-expression of BFP tagDepositorInsertADAR1 (ADAR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U8Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
p23-NES-PspCas13b-msfGFP-NES-Flag
Plasmid#165071Purposeoverexpression of PspCas13b in human cellsDepositorInsertPspCas13b
UseLentiviralExpressionMammalianAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV8-hSyn-flex-miR30-eGFP-shDyn
Plasmid#132716PurposeEncodes Cre-dependent short hairpin RNA (shRNA) that targets the 3’-untranslated region of the rat Pdyn gene, which encodes dynorphinDepositorAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHis-LMW_FGF2
Plasmid#157657PurposeExpresses FGF2 in E.coli cellDepositorInsertFibroblast growth factor 2 (FGF2 Human)
TagsHis tagExpressionBacterialMutationchanged Cystein 211,229 to serine, deleted amino …Available SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLX317-VRK1-K179E
Plasmid#199644PurposeExpresses kinase-inactive VRK1 (K179E)DepositorAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
p23-NES-PguCas13b-msfGFP-NES-Flag
Plasmid#165072Purposeoverexpression of PguCas13b in human cellsDepositorInsertPguCas13b
UseLentiviralExpressionMammalianAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
Chr7_Centromere-Targeting_gRNA
Plasmid#195129Purposedual gRNA vector targeting centromere-proximal locations on Chromosome 7p and 7q in a third generation Cas9 backbone with GFPDepositorInsertChr7 gRNA
ExpressionMammalianAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
p23-NES-LwaCas13a-msfGFP-NES-Flag
Plasmid#165070Purposeoverexpression of LwaCas13a in human cellsDepositorInsertLwaCas13a
UseLentiviralExpressionMammalianAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS
Plasmid#164565PurposeSARS-CoV-2 Spike protein (S-GSAS variant)DepositorInsertSpike (S-GSAS variant)
Tags2X Strep-Tag II, 8X His tag, and HRV3C cleavage s…ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCas9-sgVRK1 #4-Blast
Plasmid#199647PurposeExpresses Cas9 and sgRNA guide targeting VRK1DepositorInsertN/A (VRK1 Human)
UseLentiviralAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
sg_Trp53_i4-ipUSEPR-TR657
Plasmid#228930PurposeKnockdown of Trp53 in mammalian cellsDepositorInsertsg_Trp53_i4 (Trp53 sequence: GTCGCTACCTACAGCCAGGA, Mouse)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
sg_Cdkn1a_i1-ipUSEPR-TR657
Plasmid#228953PurposeKnockdown of Cdkn1a in mammalian cellsDepositorInsertsg_Cdkn1a_i1 (Cdkn1a Mouse)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
sg_Cdkn1a_i2-ipUSEPR-TR657
Plasmid#228954PurposeKnockdown of Cdkn1a in mammalian cellsDepositorInsertsg_Cdkn1a_i2 (Cdkn1a Mouse)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
AURKA_HUMAN_D0
Plasmid#79739PurposeThis plasmid encodes the kinase domain of AURKA. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT2K-LRL-IRES-Luc2
Plasmid#109230PurposeFor Tol2 transposon-mediated stable expression of LRL and IRES-luciferaseDepositorInsertLRL and Luc2
ExpressionMammalianPromoterCAGGSAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiRCas9-Lambda2
Plasmid#104184PurposeLentiviral transfer vector that carries U6-driven non-targeting sgRNA using a modified scaffold (Chen et al. Cell 2013) and CMV-driven PIN-dCas9. Derived from LentiCRISPR v2 (Zhang lab)DepositorInsertU6-sgRNA, EFS-PIN-dCas9
UseCRISPR and LentiviralAvailable SinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only